Кокковая флора в мазке что это такое у мужчин: Кокки в мазке мужчин — симптомы и лечение


Кокки в мазке мужчин — симптомы и лечение

На коже и слизистых оболочках каждого человека обитает разнообразная кокковая флора. Гонококки, пневмококки и другие являются патогенными. Стрептококки и стафилококки, которые представляют большинство данной флоры, считаются условно-патогенными. Эти микроорганизмы присутствуют в небольших количествах и в своих обычных состояниях не вредны для микрофлоры человека. Однако из-за различных неблагоприятных факторов число стрептококков и других микроорганизмов стремительно растет и провоцирует воспалительный процесс. 


Если в мазке у мужчин обнаружено большое количество кокков, могут проявляться такие симптомы:

  • жжение во время мочеиспускания;
  • болезненность нижней части живота;
  • слизь или слизисто-гнойные выделения из уретры.

Но эти признаки характерны не для единичных заболеваниях. Перечисленные симптомы могут быть при уретрите (воспалении мочеиспускательного канала). Поэтому без проведения анализов установить причину воспаления невозможно. Также стоит учесть, что при осложнениях уретрита палочка кокки может находиться в предстательной железе, семенных пузырьках, яичках, а не только в уретре. 

Факторы, которые сопутствуют кокобацилярной флоре:

  • плохая гигиена;
  • дисбактериоз кишечника;
  • регулярная смена половых партнеров;
  • ухудшение иммунитета;
  • плохое питание.

Грамположительные кокки в мазке у мужчин выявляются после передачи инфекции половым путем.

Диагностика заболевания

После обнаружения кокков в мазке у мужчин, необходимо пройти более тщательное обследование и лечение. Если воспаление ярко-выражено, кроме кокобацилярной флоры в поле зрения обнаруживается более 20 лейкоцитов, а также более 10 клеток эпителия. 

Мазок, взятый из уретры, исследуют следующими методами:

  • ПЦР позволяет определить ЗППП. Этот анализ важен, так как заболевания, передающиеся половым путем, достаточно распространены, и многие из них вызывают опасные осложнения;
  • бактериологический посев на питательные среды позволяет определить чувствительность к антибиотикам. Этот анализ дает понимание о бактериальной нагрузке, другими словами, о количестве кокков.

Как правильно сдавать анализ?

Чтобы получить достоверный результат, необходимо:

  1. Не мочиться за 2 часа до взятия мазка.
  2. За 1–2 дня до проведения обследования не иметь половых контактов.
  3. Не делать лечебные инстилляции в уретру.
  4. Необходимо перенести сдачу анализа, если мужчина принимает антибактериальные препараты.

Как быстро вылечить заболевание (кокки в мазке у мужчин)?

Если в мазке у мужчин в большом количестве обнаружены полиморфные кокки, необходимо срочно принимать меры. Обратитесь за консультацией и назначением лечения к специалисту, если норма кокков превышена. Помните, что самолечение категорически не рекомендуется. 

Автор статьи — Мельников Сергей Юрьевич, главный врач, дерматовенеролог, уролог, миколог, андролог высшей врачебной категории.

Читайте также:

Что показывает мазок на флору?

Методика мазка на флору очень проста. При осмотре в зеркалах берётся отделяемое со слизистой оболочки уретры, шейки матки и влагалища. Наносится на предметной стекло, высушивается, окрашивается, после чего врач-лаборант исследует препарат под микроскопом.

Это не больно, безопасно, быстро и недорого.
Условия для качественного мазка:
— вне менструации
— накануне исключить вагинальные свечи, таблетки, спринцевания, ванны
— за 1-2 дня не иметь половые контакты
— за 1-2 часа не мочиться
Нормальный мазок — это:
— умеренное количество слизи и клеток эпителия
— количество лейкоцитов до 10 в поле зрения в уретре и влагалище, до 30 — в цервикальном канале
— преобладание грам+ палочковой флоры
— отсутствие гонококков, трихомонад, ключевых клеток, кандида.
О чем могут свидетельствовать отклонения от нормы?

✳ Повышение лейкоцитов (а это наши защитники при любой инфекции) — признак воспаления. Количество слизи и клеток плоского эпителия при воспалении также повышено. Ставим диагноз вагинит, цервицит и назначаем лечение.
✳Выявлены ключевые клетки, гарднереллы, лептотриксы, снижено количество лактобацилл, преобладает кокковая флора — бак. вагиноз (дисбактериоз влагалища), промежуточное состояние между нормой и патологией, снижение местного иммунитета, условие для воспаления. Основная цель терапии — нормализация микрофлоры и рН влагалища.
✳При кандидозе (молочнице) в мазке выявляются нити мицелия и(или) споры гриба. Если есть жалобы, признаки воспаления — лечим.

✳С гонореей, трихомониазом, я думаю, все понятно. Лечение без вариантов.
Надо чётко понимать, что мазок на флору — лишь базовое исследование.
Хламидии, микоплазмы, уреоплазмы — слишком мелкие микробы и в мазке на флору не определяются.
Мазок на флору не показывает количество и соотношение микробов, не даёт чувствительность к антибиотикам. Для этого используются другие методы. 


Есть вопросы? Напишите доктору.

Кокки в мазке у мужчин: основные причины

В настоящее время для постановки диагноза какого-либо заболевания очень важна лабораторная диагностика. Она включает в себя общие анализы, микроскопию взятого биологического материала. Очень часто в ходе лабораторных исследований выявляются различные микроорганизмы. Это могут быть вирусы, бактерии, хламидии, грибки и другие. Среди них особое значение имеют кокки. Кокки относятся к бактериям. Они могут свидетельствовать о различной патологии.

Признаки заболевания мочеполовой системы (клинические проявления) не могут в полной степени подтвердить диагноз. Обнаружение микроорганизмов данной группы позволяет поставить окончательный вердикт. Нужно отметить, что обнаружение их в мазке у мужчин проводится с целью назначения адекватного лечения. Медикаментозная терапия при каждом возбудителе отличается. Лабораторные методы диагностики позволяют определить чувствительность к антибиотикам микробов. От этого во многом зависит успех лечения больного мужчины. Рассмотрим более подробно, при каких заболеваниях обнаруживаются кокки в мазке у мужчин, основные причины их появления.

Содержание кокков в норме

В зависимости от причины, содержание кокков в мазке может быть различным. При остром процессе число бактерий больше, нежели при хроническом. Важно, что кокки являются условно-патогенной микрофлорой мужчины. Это означает, что подобные бактерии присутствуют на коже и слизистых оболочках здорового человека, но в небольших количествах. Если их число резко возрастает или они начинают проявлять патогенные свойства, то это свидетельствует о заболевании. Способствует этому снижение резистентности организма, переохлаждение, стрессы и другие факторы. Кокковая флора в мазке оценивается по количественному признаку. Немаловажное значение имеет то, что косвенным показателем наличия бактерий в исследуемом материале является увеличение числа лейкоцитов, эпителиальных клеток, слизи.

Физиология организма человека такова, что при чрезмерном размножении бактерий (кокков) в очаг воспаления приходят лейкоциты. Они являются фактором иммунитета и защищают организм. Если при взятии мазка наблюдается наличие гнойных выделений, то это указывает на большое количество мертвых бактерий и лейкоцитов.

В норме кокки в мазке обнаруживаются в единичном количестве. Допускается только такое их число в поле зрения микроскопа. Отдельно определяются гонококки. У здорового человека они должны отсутствовать в поле. Что же касается эпителия, то нормальное его содержание составляет 5-10 в поле зрения. Нормальным считается не более 5 лейкоцитов. Слизь должна содержаться в умеренном количестве.

Причины увеличения количества кокков


У мужчин кокки в мазке могут быть разными. Выделяют стафилококки, стрептококки, гонококки, пневмококки. Пневмококки в большей степени выделяют из верхних дыхательных путей. В зависимости от возбудителя симптомы различаются. Стафилококки и стрептококки являются обитателями кожных покровов. Чаще всего при взятии мазка и исследовании имеет место смешанная флора. Она может быть представлена кокками, кишечной палочкой, протеем, грибками и другими микроорганизмами. Очень редко выявляются только одни кокки у мужчин. Каковы причины подобного явления? Если кокки обнаружены в мазке в ненадлежащем количестве, то это может быть следствием развития инфекции. Кокковая инфекция обусловлена различными факторами.

Во-первых, причиной являются беспорядочные половые акты. Большое значение имеют незащищенные контакты. Известно, что половым путем передается гонорея, трихомоноз и другие инфекции. Наличие в мазке у мужчин гонококков может указывать на гонорею. Во-вторых, потенциальную опасность представляет анальный и оральный секс. В-третьих, подобная микрофлора может развиться у мужчин, которые пренебрегают правилами личной гигиены своих половых органов. Существуют и другие причины: мастурбация, ранняя половая жизнь, дисбактериоз.

Последний является очень актуальной проблемой на сегодняшний день. При длительном приеме антибактериальных средств во многом страдает полезная микрофлора мужчин, которая защищает организм от патогенных бактерий. Это является отличным предрасполагающим факторам для размножения кокков. Кокки в мазке в большом количестве могут указывать на наличие очагов хронической инфекции. Кроме этих причин, существуют и другие предпосылки (переохлаждение, снижение иммунитета, нерациональное питание).

Как взять мазок у мужчин

Для определения наличия инфекции мочеполовой системы потребуется грамотно взять мазок из уретры мужчин. Кокки в мазке определить нетрудно, но сама процедура может быть для обследуемого человека очень неприятной и даже болезненной. Первым делом больного необходимо проконсультировать. Врач должен объяснить, как должен подготовить себя больной для данной процедуры. Мужчина за 2 дня до проведения манипуляции должен отказаться от сексуальных контактов. Кроме того, за день до взятия мазка требуется провести тщательный туалет наружных половых органов. Делается это накануне вечером. Очень важно то, что непосредственно в утреннее время перед процедурой мыться нельзя.

Рекомендуется не ходить в туалет по-маленькому перед походом к врачу.

Большое значение имеет тот факт, что взятие мазка после приема антибактериальных препаратов нецелесообразно.

Пациент должен отказаться от любой медикаментозной терапии за 1-2 недели до процедуры. В противном случае результаты могут быть недостоверными. Чтобы обнаружить кокки в мазке, больному проводится болезненная процедура. Она заключается во введении в уретру специального тампона или зонда на глубину около 3 см. Все материалы и инструменты должны быть стерильными. Это имеет огромное значение, так как очень часто подобные манипуляции способствуют заносу инфекции извне. Нужно помнить, что после забора материала больного может беспокоить боль, жжение, дискомфорт в уретре, но данные симптомы быстро проходят.

Симптомы наличия кокков в мазке

Если в организме мужчин присутствуют в большом количестве кокки, то признаки инфекции могут быть налицо. Кокковая инфекция органов мочеполовой системы может проявляться сухостью слизистой оболочки, зудом, жжением. При остром воспалительном процессе из мочеиспускательного канала могут быть различные выделения. Нередко они имеют примесь гноя. Лечение в этом случае должно осуществляться немедленно. Симптомы включают в себя болезненные ощущения, дискомфорт, нарушение акта мочеиспускания. В более тяжелых случаях у больных отмечаются общие симптомы: слабость, повышение температуры тела.

В большинстве случаев обнаружение кокков в мазке в большом количестве указывает на такие заболевания, как цистит, уретрит, простатит. При этом нужно учитывать клинические симптомы. Если лечение проводится несвоевременно, то это может привести к осложнениям. При этом признаки могут быть более тяжелыми. Любая инфекция органов мочеполовой системы способна распространяться на другие участки. Важно, что совместно с обнаружением кокков в мазке проводится посев и полимеразная цепная реакция.

Лечение кокковой инфекции

Лечение любого заболевания органов мочеполовой системы, вызванного кокками, обязательно. Как и все бактерии, кокки чувствительны к антибактериальным препаратам. Наиболее часто при заболеваниях мочеполовой системы лечение включает в себя применение лекарственных препаратов из группы фторхинолонов, тетрациклинов и макролидов. Они позволяют ликвидировать симптомы. Перед назначением лечения врач должен определить чувствительность кокков к антибиотикам, оценить симптомы. Признаки могут совсем отсутствовать.


Для того чтобы поддерживать постоянство микрофлоры организма мужчины, необходимо соблюдать следующие правила: использовать презервативы при сексуальных контактах, исключить случайные половые связи, соблюдать правила личной гигиены, вовремя лечить хронические заболевания, правильно питаться, вести здоровый образ жизни. Таким образом, кокки могут свидетельствовать о самых различных заболеваниях у мужчин.

Мужское здоровье от А до Я в журнале «Здоров, как бык!»

Будь здоров на 100%!

Каждый мужчина мечтает всегда быть в тонусе, полным энергии и обладать отменным здоровьем, вплоть до 100 лет. К сожалению, очень мало кому это удается. Мешают этому прежде всего, неправильный образ жизни, вредные привычки, да и плохая экология, вероятно, вносит свою лепту. И это, не говоря уже о постоянных стрессах современной жизни, с которыми мужчины, как уже давно доказано учеными, справляются значительно хуже, чем представительницы прекрасного пола.

Все вышеперечисленное конечно имеет место быть, но скорее служит хорошим самооправданием для тех, кто никогда особо не заботился о своем здоровье, и вдруг спохватился, только когда что-то заболело и стало функционировать как-то не так, например, стали появляться симптомы простатита или начала снижаться потенция. А ведь простой профилактикой можно значительно снизить риск многих неприятных заболеваний, таких, как аденома предстательной железы, которые могут возникнуть с возрастом.

Любая женщина подтвердит, что мужчинам не особо свойственна постоянная забота о своем здоровье, особенно пока все ОК, и не возникает явных причин для беспокойства, таких как, например, ранняя импотенция. И в этом кроется одна из причин, почему сильный пол живет меньше, чем пол слабый. Статистика на данный счет имеется и она весьма нерадостна.

Целый раздел медицины, андрология, изучает мужское здоровье, но совершенно необязательно самому быть доктором, чтобы хотя бы знать, какие могут быть болезни, какие у них признаки, и как их предотвратить профилактическими средствами. Как говорится, осведомлен о том, что такое хронический простатит, значит вооружен, и в этом мы, искренне надеемся, сможем вам помочь.

Информационный портал «Здоров, как бык!» создан с очень важной целью — помочь мужчинам, как можно дольше сохранять себя здоровыми и крепкими, радовать своих любимых женщин и вообще жить полноценной энергичной жизнью, хоть в 18, хоть в 70 лет.

На страницах нашего проекта вы найдете массу полезной информации о подстерегающих мужчин недугах, симптоматике данных заболеваний, и, конечно, о методах их профилактики и лечения.

Полезная информация?

Поделитесь ей с друзьями и они обязательно поделятся чем-то интересным и полезным с Вами! Это очень легко и быстро, просто нажмите кнопку сервиса, которым чаще всего пользуетесь:

Мужское здоровье от А до Я в журнале «Здоров, как бык!»

Будь здоров на 100%!

Каждый мужчина мечтает всегда быть в тонусе, полным энергии и обладать отменным здоровьем, вплоть до 100 лет. К сожалению, очень мало кому это удается. Мешают этому прежде всего, неправильный образ жизни, вредные привычки, да и плохая экология, вероятно, вносит свою лепту. И это, не говоря уже о постоянных стрессах современной жизни, с которыми мужчины, как уже давно доказано учеными, справляются значительно хуже, чем представительницы прекрасного пола.

Все вышеперечисленное конечно имеет место быть, но скорее служит хорошим самооправданием для тех, кто никогда особо не заботился о своем здоровье, и вдруг спохватился, только когда что-то заболело и стало функционировать как-то не так, например, стали появляться симптомы простатита или начала снижаться потенция. А ведь простой профилактикой можно значительно снизить риск многих неприятных заболеваний, таких, как аденома предстательной железы, которые могут возникнуть с возрастом.

Любая женщина подтвердит, что мужчинам не особо свойственна постоянная забота о своем здоровье, особенно пока все ОК, и не возникает явных причин для беспокойства, таких как, например, ранняя импотенция. И в этом кроется одна из причин, почему сильный пол живет меньше, чем пол слабый. Статистика на данный счет имеется и она весьма нерадостна.

Целый раздел медицины, андрология, изучает мужское здоровье, но совершенно необязательно самому быть доктором, чтобы хотя бы знать, какие могут быть болезни, какие у них признаки, и как их предотвратить профилактическими средствами. Как говорится, осведомлен о том, что такое хронический простатит, значит вооружен, и в этом мы, искренне надеемся, сможем вам помочь.

Информационный портал «Здоров, как бык!» создан с очень важной целью — помочь мужчинам, как можно дольше сохранять себя здоровыми и крепкими, радовать своих любимых женщин и вообще жить полноценной энергичной жизнью, хоть в 18, хоть в 70 лет.

На страницах нашего проекта вы найдете массу полезной информации о подстерегающих мужчин недугах, симптоматике данных заболеваний, и, конечно, о методах их профилактики и лечения.

Полезная информация?

Поделитесь ей с друзьями и они обязательно поделятся чем-то интересным и полезным с Вами! Это очень легко и быстро, просто нажмите кнопку сервиса, которым чаще всего пользуетесь:

Мужское здоровье от А до Я в журнале «Здоров, как бык!»

Будь здоров на 100%!

Каждый мужчина мечтает всегда быть в тонусе, полным энергии и обладать отменным здоровьем, вплоть до 100 лет. К сожалению, очень мало кому это удается. Мешают этому прежде всего, неправильный образ жизни, вредные привычки, да и плохая экология, вероятно, вносит свою лепту. И это, не говоря уже о постоянных стрессах современной жизни, с которыми мужчины, как уже давно доказано учеными, справляются значительно хуже, чем представительницы прекрасного пола.

Все вышеперечисленное конечно имеет место быть, но скорее служит хорошим самооправданием для тех, кто никогда особо не заботился о своем здоровье, и вдруг спохватился, только когда что-то заболело и стало функционировать как-то не так, например, стали появляться симптомы простатита или начала снижаться потенция. А ведь простой профилактикой можно значительно снизить риск многих неприятных заболеваний, таких, как аденома предстательной железы, которые могут возникнуть с возрастом.

Любая женщина подтвердит, что мужчинам не особо свойственна постоянная забота о своем здоровье, особенно пока все ОК, и не возникает явных причин для беспокойства, таких как, например, ранняя импотенция. И в этом кроется одна из причин, почему сильный пол живет меньше, чем пол слабый. Статистика на данный счет имеется и она весьма нерадостна.

Целый раздел медицины, андрология, изучает мужское здоровье, но совершенно необязательно самому быть доктором, чтобы хотя бы знать, какие могут быть болезни, какие у них признаки, и как их предотвратить профилактическими средствами. Как говорится, осведомлен о том, что такое хронический простатит, значит вооружен, и в этом мы, искренне надеемся, сможем вам помочь.

Информационный портал «Здоров, как бык!» создан с очень важной целью — помочь мужчинам, как можно дольше сохранять себя здоровыми и крепкими, радовать своих любимых женщин и вообще жить полноценной энергичной жизнью, хоть в 18, хоть в 70 лет.

На страницах нашего проекта вы найдете массу полезной информации о подстерегающих мужчин недугах, симптоматике данных заболеваний, и, конечно, о методах их профилактики и лечения.

Полезная информация?

Поделитесь ей с друзьями и они обязательно поделятся чем-то интересным и полезным с Вами! Это очень легко и быстро, просто нажмите кнопку сервиса, которым чаще всего пользуетесь:

Кокки в мазке у мужчин лечение препараты. Кокковая флора в мазке. Симптомы и лечение. Принципы эффективного лечения

Ежегодно женщина должна проходить гинекологический осмотр и сдавать необходимые анализы. Одним из важных анализов, благодаря которому можно определить состав флоры и выявить возможные патогенные микроорганизмы, является . В результатах могут присутствовать условно-патогенные и патогенные бактерии – кокки.

Кокки – шарообразные бактерии. Их диаметр составляет 0,2-4,5 мк. Они локализуются не только в дыхательных путях, но и на слизистой половых органов. Некоторые виды кокков присутствуют в организме постоянно и являются условно-патогенными. При создании благоприятных условий они могут стать причиной воспалительного процесса.

Количество нормальных разрядов варьируется от женщины к женщине и увеличивается во время овуляции, предменструально и во время беременности. Нормальный разряд не имеет неприятного запаха и не связан с вагинальным раздражением, зудом или горением. Разнообразные тесты и культуры могут быть сделаны на выделениях, полученных во время тазового обследования. Ни один из них не является более важным, чем микроскопическое исследование. Чтобы подготовить влажную предварительную обработку, используйте один из двух следующих способов.

Поместите каплю солевого раствора на слайд и добавьте небольшое количество слива.

  • Поместите образец в 1 мл физиологического раствора и перемешайте.
  • Возьмите каплю этой смеси и поместите ее на слайд.
В любом случае накройте крышку. Первый способ является предпочтительным, если разряд является обильным, так как он будет разбавлять выделения таким образом, чтобы отдельные клетки могли быть лучше видны.

Выделяют несколько разновидностей кокковой флоры:

  • . Они становятся причиной дисбактериоза влагалища и воспалительных процессов в половых органах.
  • . Это условно-патогенная грамположительная бактерия. Встречается на слизистой оболочке половых путей довольно часто. При быстром размножении стафилококков наблюдаются расстройства мочеполовой системы.
  • Энтерококки. Это представители кишечной микрофлоры. Их присутствие в мазке свидетельствует о несоблюдении правил личной гигиены.
  • Гонококки. Поражают мочеполовую систему и также выявляются в мазке. У женщин гонококки провоцируют развитие цервицита и сальпингита. Воспалительный процесс развивается очень быстро.

Кроме вышеперечисленных кокков, в мазке у женщины могут присутствовать коккобациллы и диплококки. Коккобациллярная флора указывает на бактериальный вагиноз и . Диплококки являются разновидностью менингококковой и пневмококковой инфекции.

Типичное состояние микрофлоры влагалища

Скольз может быть разогрет ненадолго, и его следует быстро рассмотреть. Тщательный поиск нескольких полей должен производиться как на средней, так и на высокой мощности для трихомонады, клеточных клеток и дрожжей. Трихомонады — это подвижные жгутиковые организмы размером с лейкоциты. Они лучше всего распознаются их характерным крутящим движением. Ключами клеток являются вагинальные эпителиальные клетки с адгезивными коккобациллами. Дрожжи можно рассматривать как почкообразные или гифальные формы, и их можно увидеть лучше всего с добавлением гидроксида калия.

Причины и симптомы

В кислой среде, которую обеспечивают бифидумбактерин, палочки Додерлейна и пептострептококки, болезнетворные микроорганизмы погибают. Когда защитные функции организма ослабевают, то кокки активно размножаются. При этом повышается кислотность влагалища.

Менингококки — враги слизистых оболочек мозга

Наконец, следует отметить наличие или отсутствие большого количества лейкоцитов. Некоторые из них могут быть нормальными, но более 10 на высокомощное поле являются ненормальными. Следует провести дополнительную мазку, а некоторые разряды — на слайде. Добавьте каплю 10% -ного гидроксида калия и накройте крышкой. Нагрейте слайд только до тех пор, пока пузырьки не станут под крышкой, но больше не будут. Это способствует лизису клеток, но оставляет грибы. Затем слайд следует тщательно изучить для присутствия почкообразных дрожжей или гиф.

Размножение во влагалище кокков может быть обусловлено следующими причинами:

  • Бесконтрольное употребление антибиотиков.
  • Инфекционные заболевания, передающиеся половым путем.
  • Частое спринцевание.
  • Несоблюдение гигиены.
  • Беспорядочная половая жизнь.
  • Ношение синтетического белья.

Кокки могут появиться у девушек, которые рано начали вести половую жизнь и часто меняют сексуальных партнеров. Нередко причиной развития патогенной микрофлоры может быть мастурбация, при которой использовались не дезинфицированные предметы или грязные руки.

Тест-тест — тест на рыбный запах, который возникает при бактериальном вагинозе. Положительный тест является ненормальным и состоит из характерного рыбного запаха. Пятна грамма выделения из влагалища могут быть сделаны с использованием стандартных методов. Дрожжи будут обнаружены, и можно оценить преобладающую бактериальную флору. Ключ-ячейки можно точно идентифицировать.

Крах пятна эндоцервикальной слизи может быть полезен при оценке цервицита. Это относительно нечувствительный тест, однако, и не должен подменять культуру. Избыток лейкоцитов в слизистой оболочке эндоцервика предполагает хламидийный цервицит, и необходимо провести соответствующие исследования. Помимо информации о цитологии шейки матки, мазок Папаниколау часто добавляет информацию о возможных вагинальных и цервикальных патогенах. Например, можно увидеть трихомонады или дрожжи. Некоторые цитологические изменения могут предполагать хламидийный цервицит.

На появление кокков могут указывать следующие симптомы:

  • Увеличение слизистых выделений.
  • Жжение и зуд в области половых органов.
  • Неприятный запах.

Со временем вязкость и густота слизи повышается. Она может менять оттенок от белого до желтоватого. При наличии некоторых из указанных симптомов необходимо обратиться к гинекологу и сдать . По результатам анализа будет назначено лечение.

Эндоцервикальные и эктоцервикальные мазки Папаниколау должны быть получены, как описано в главе 179. Культуры никогда не должны заменять тщательную историю, физическое обследование и микроскопическое исследование влажной подготовки. В зависимости от результатов вагинальной культуры без микроскопического исследования секреции будут возникать частые ошибки в лечении. Тем не менее, цервикальные культуры могут быть особенно полезными в некоторых случаях.

Причины нарушения баланса микрофлоры

Дрожжи будут расти как по обычной культуре, так и по конкретным средам. В идеале это должно быть немедленно нанесено на конкретную среду, так как задержка резко снижает урожай. Хламидийные культуры дороги и требуют недели для получения результатов. Недавно появились технологии иммунофлуоресценции. Они дешевле, и результаты доступны раньше. Патологические влагалищные выделения вызваны различными инфекционными и неинфекционными причинами. Разряд может быть вызван инфекциями самого влагалища, но инфекции или воспаление шейки матки также приводят к увеличению выделения из влагалища.

У мужчин кокки встречаются редко. При болезненных ощущениях во время мочеиспускания, выделений из пениса желтого или зеленого цвета следует обратиться к урологу. Такие симптомы могут указывать на гонококки или трихомонады.

Для выявления патогенной микрофлоры во влагалище, в канале шейки матки и мочеиспускательном канале сдается мазок на флору. Это лабораторное микроскопическое исследование, которое позволяет обнаружить , грибок, кокки, трихомонады, лактобациллы.

У многих пациентов присутствует несколько причин. Тщательная история и физическое может помочь разделить эти два условия и указать на этиологию. При тазовом осмотре следует уделять пристальное внимание присутствию или отсутствию воспаления шейки матки, обычно проявляющемуся как отек или хрупкость, а также наличие или отсутствие цервикального мукопуса, то есть мукопурулезные выделения в эндоцервикальном канале.

Три основные причины вагинита — трихомонады, кандидоз и бактериальный вагиноз. Их можно отличить соответствующими лабораторными испытаниями. Он растет лучше всего в умеренно анаэробных условиях, когда рН составляет 6. Его можно наблюдать у бессимптомных женщин, но при симптоматическом действии он вызывает отбеливание от белого до желтого, которое может быть пенистым. Классические находки вагинальных петехий относительно нередки. Во флористических случаях мокрое приготовление обнаруживает многочисленные подвижные организмы, но в более мягких случаях необходимо тщательно осмотреть многие поля, чтобы увидеть один или два подвижных организма.

Показаниями для сдачи мазка на флору являются:

  • слизистые или молочные выделения из влагалища
  • зуд и жжение
  • боль внизу живота
  • смена полового партнера

Кроме того, сдают анализы при планировании беременности, а также длительном приеме антибиотиков.

Для получения достоверных результатов к сдаче анализов необходимо подготовиться.

Мокрая подготовка не чувствительна на 100%. Было установлено, что положительные положительные результаты в отношении культуры положительные в 50-60% случаев. Хотя культуры более точны, они недоступны в большинстве лабораторий. Поэтому трихомонады нельзя исключать у пациентов с отрицательной влажной подготовкой. Мазки Папани могут также выявить трихомонады.

Мазок на флору: расшифровка

У разряда с большим количеством лейкоцитов у пациента, у которого нет цервицита, имеются трихомонады. Если имеется разряд, обычно это густой, белый, так называемый творог. Мокрая подготовка показывает нормальные эпителиальные клетки. Бактерии — это нормальные лактобактерии. Мокрая подготовка может выявить дрожжи, как почкообразные формы или псевдогифы. Гидроксид калия несколько более чувствителен, но его чувствительность варьируется, составляя до 20% в некоторых сериях положительных к культуре пациентов.

За два дня до забора мазка следует отказаться от половых связей, не использовать вагинальные препараты, не выполнять спринцевания. Непосредственно перед исследованием не подмываться и не мочиться. После менструации анализы сдаются на 4-5 сутки.

Диагностика и норма

Неспецифический или бактериальный вагиноз

Поэтому лечение часто должно основываться только на клинических подозрениях. Культуры более точны, чем только микроскопическое исследование, но значение положительной культуры у бессимптомного пациента неизвестно, поэтому культуры следует проводить только для подтверждения подозрительных случаев. Возможно, эта форма вагинита наиболее распространена.

Цервицит может вызывать гнойные выделения из шейки матки. Разряд не будет иметь запаха и будет состоять из листов белых кровяных телец; рН влагалища варьируется. Необходимо провести соответствующие тесты на гонорею и тесты на хламидии, но лечение нельзя откладывать, потому что может возникнуть восходящая инфекция.

Забор мазка на флору осуществляется гинекологом. Женщина располагается в гинекологическом кресле и ставит ноги на специальные опоры. Далее половые органы обрабатывают антисептиками. Затем вводят и осуществляют сбор материала с задней стенки влагалища. После этого материал наносят на предметное стекло и распределяют равномерно штриховыми движениями по стеклу.

В таблице 1 приведены лабораторные данные. Вагинит и цервицит являются чрезвычайно распространенными заболеваниями и несут ответственность за многие посещения офиса и большой дискомфорт для пациентов. Цервицит может привести к серьезным восходящим инфекциям и последующему бесплодию в трубах. Из-за этого, точный и быстрый диагноз является обязательным. Нет никакого оправдания для того, чтобы попытаться диагностировать причину выделения из влагалища без использования лабораторных тестов. Важнейшей является мокрая подготовка, которая позволяет клиницисту различать три общие причины вагинита.

Взятый материал отдают в лабораторию для дальнейшего исследования. Далее мазок окрашивают по методу Грама, благодаря чему можно установить вид бактерий и состав микрофлоры.

Мазок на исследование берут из трех участков: уретры, стенок влагалища и канала шейки матки. Инфекционно-воспалительный процесс протекает взаимосвязано, поэтому мазок берется из трех участков. Эта процедура безболезненная и занимает всего несколько минут. В норме уровень щелочного баланса должен находиться в пределах 5,5-7. Если количество кокков превышает указанный диапазон, то это свидетельствует об инфекционно-воспалительном процессе.

Особенности лечения и профилактика

В некоторых случаях следует проводить скрининг культур для гонореи и тесты на хламидии. Эти случаи могут включать женщин, которые имеют другие заболевания, передающиеся половым путем, такие как трихомонады; женщины с несколькими сексуальными партнерами; и, возможно, другие группы. Культуры являются обязательными у женщин с мукопурулезным цервицитом.

Бактериальный вагиноз является распространенной причиной аномального выделения из влагалища и неприятного запаха у женщин репродуктивного возраста. У некоторых женщин, однако, не будет никаких симптомов. Он не передается половым путем или заразителен. Ранее он назывался неспецифическим вагинитом.

О том, что в микрофлоре влагалища повышена щелочная среда, указывает рН более 7,5.

Кокки делятся на грамположительные и грамотрицательные. Присутствие грамположительных бактерий (стрептококков и стафилококков) в мазке допускается. Грамотрицательные кокки провоцируют развитие многих заболеваний.

Кокки в мазке: о чем свидетельствует их наличие

В чем причина бактериального вагиноза?

Бактериальный вагиноз обусловлен нарушением нормального бактериального равновесия во влагалище. Лактобациллы обычно являются наиболее распространенными бактериями во влагалище. Это анаэробные бактерии, т.е. они растут в отсутствие кислорода. Предрасполагающие факторы для бактериального вагиноза включают недавнее использование антибиотиков, снижение производства эстрогенов, внутриматочное устройство и увеличение числа сексуальных партнеров. Это связано с повышением рН во влагалище.

Каковы клинические особенности бактериального вагиноза?

Запах сливочно-белой пенной выпивки является наиболее распространенной жалобой на бактериальный вагиноз с положительным «свистящим» тестом. Он иногда зеленоватый по цвету и может быть липким. Вульва и влагалище не воспаляются. Однако, разряд может быть раздражающим, что приводит к появлению симптомов на коже вокруг влагалища.

Мазок содержимого влагалища на флору является обязательным, и забор осуществляют при каждом гинекологическом осмотре. Результаты позволяют определить возможные болезнетворные микроорганизмы.

Если во влагалище среда щелочная и рН сильно отличается от нормы, то лактобактерии погибают и их место занимают большое количество кокков. Это свидетельствует не только о воспалительном процессе, но и развитие дисбактериоза. При дисбактериозе появляются обильные выделения с неприятным запахом из влагалища, болезненные ощущения во время полового акта, жжение во время мочеиспускания.

Зуд Стинг Чувствительность контакта, например, мочи, одежды, езды на велосипеде. . У большинства женщин нет осложнений от бактериального вагиноза. Есть некоторые риски во время беременности, включая преждевременные роды и воспаление вокруг плода. Также может быть связь с воспалительным заболеванием таза.

Как диагностируется бактериальный вагиноз?

При бактериальном вагинозе вагинальный мазок показывает, что нормальные вагинальные лактобациллы заменяются несколькими небольшими кокками. Это небольшие круглые бактерии, тогда как лактобациллы удлиняются. Также видны ячейки «Ключ»; это эпителиальные клетки от облицовки влагалища со многими кокками, приверженными их, например. Вагинальный рН повышен у большинства пациентов, в отличие от вульвовагинального кандидоза, когда он снижается ниже.

При длительном воспалительном процессе кокки продолжают активно размножаться, и это может стать причиной развития и эрозии шейки матки. Если не предпринимать меры и не лечить заболевания, то это может привести к .

Полезное видео — Кокки в мазке:

У беременной женщин наличие кокков в мазке усложняет течение беременности. В дальнейшем воспалительный процесс переходит на прямую кишку, мочевую систему, а это все отражается на развитии плода.

Наличие пневмококков может привести к воспалению легких, гонококки – к гонорее, а менингококки – к менингиту. Эти патогенные бактерии распространяются на плод и могут угрожать жизни. Важно не откладывать визит к врачу и своевременно начать лечение.

Особенности лечения и профилактика

При подборе эффективной медикаментозной терапии рекомендуется проверить кокки на чувствительность к антибиотикам. С этой целью проводится .

Антибиотикограмма позволяет врачу правильно подобрать антибактериальный препарат для лечения. Если кокки присутствую в мазке, но симптомов никаких не наблюдается, то лечение не требуется.

Особенности лечения:

  • Антибиотики могут назначаться для системного использования или локального воздействия. В первом случае используют таблетки или растворы для инъекций, а во втором — препараты в виде свечей и таблеток для введения во влагалище. Курс лечения антибиотиками составляет 7-10 дней. Из антибактериальных препаратов обычно назначают Метронидазол. При аллергии на этот препарат используют Клиндамицин или Тинидазол.
  • Для устранения симптомов назначают антигистаминные препараты. Кроме того, для активизации работы иммунной системы рекомендуется применение иммуномодуляторов.
  • После антибактериальной терапии желательно использование пробиотиков, которые помогают восстановить микрофлору влагалища. Нередко кокки могут появляться в мазке вновь. При необходимости следует пройти дополнительный курс лечения и воспользоваться вспомогательными средствами.

Следует знать, что если в мазке у одного из партнеров обнаружены кокки, то лечение необходимо пройти как женщине, так и мужчине. На время лечения важно соблюдать половой покой. В противном случае лечение не будет иметь смысла.

В целях профилактики, чтобы предотвратить появление кокков в мазке, необходимо придерживаться следующих рекомендаций:

  1. Ежедневно выполнять гигиенические процедуры. Нежелательно часто пользоваться ежедневными прокладками.
  2. Каждый день менять нижнее белье.
  3. Избегать случайных связей. Если партнер непроверенный, то использовать презерватив.
  4. Не проводить часто спринцевания. Данная процедура влияет на микрофлору, поэтому выполнять следует только по рекомендации врача.
  5. Половая жизнь должна начинаться только после полного созревания. Важно помнить, что раннее начало половой жизни может иметь неприятные последствия.
  6. Повышать иммунитет. Употреблять в пищу достаточное количество овощей и фруктов, правильно питаться, заниматься спортом.
  7. Регулярно сдавать и проходить гинекологический осмотр.

Различные представители рода стрептококков мирно сосуществуют в человеческом организме. При нормальном, здоровом состоянии стрептококки в мазке у мужчин не являются признаком патологического процесса.

Нормальная микрофлора

Направление на микробиологический посев и выявление состава микрофлоры мочеполовых путей у мужчин доктор дает в случае, если появляются симптомы раздражения в уретре. При обычном, здоровом состоянии вряд ли кто-то из представителей сильного пола обратиться с подобной просьбой к врачу.

Микробный пейзаж нормальной мужской микрофлоры представлен следующими микроорганизмами:

  • стрептококками;
  • пептококками;
  • бациллярными представителями;
  • микрококками;
  • немного стафилококков;

Количество и соотношение каждого представителя указывает на здоровье мужской мочеполовой системы. Появление патогенных микроорганизмов или существенный рост количества какого-либо из участников нормального биоценоза сообщает о нарушении иммунитета или заболевании этого локуса.

Мазок берется после специальной подготовки, стерильным тампоном. После чего доставляется в лабораторию не позднее двух часов с момента взятия анализа. Самую большую долю в нормальном составе микрофлоры имеет пептококк, который также является стрептококком, только не имеющим патогенных свойств. Он может насчитывать число колониеобразующих единиц (КОЕ) в результатах до 10 в 5 степени от общего числа микроорганизмов.

Отсутствие патогенных представителей микроорганизмов, таких как гонококк, трихомонада, присутствие нормальных представителей микрофлоры в приемлемых количествах свидетельствует об отсутствии дисбактериоза мочеполовой системы и нормальном состоянии местного иммунитета.

Наличие стрептококка в мазке

Если мазок показал стрептококк на повышенном уровне, при этом присутствуют симптомы раздражения, инфицирования, нагноения, то можно предположить, что возникла именно стрептококковая инфекция. Упомянутые выше пептококки являются аналогами лактобактерий в нормальном женском биоценозе. Пептококки также представляют стрептококки, только способствующие восстановлению, поддержанию рН на нормальном уровне.

Возрастание доли стрептококков других видов, в том числе патогенных, сообщает о наличии источника инфекции в организме человека или воспалительном процессе непосредственно в месте исследования. Причины возникновения стрептококк агалактия в мазке из уретры могут быть различными:

  • ослабленный иммунитет;
  • несоблюдение гигиены половой жизни;
  • пренебрежение личной гигиеной;
  • прием антибактериальных препаратов;
  • инфекции, передающиеся половым путем.

Наличие очагов хронической инфекции в организме, таких как ангина, фарингит может провоцировать различные болезни, которые вызывает стрептококк у ребенка или у взрослого в других органах или системах. Особенно это проявляется при ослаблении иммунитета при переохлаждениях, гиповитаминозах, хронических заболеваниях, например, сахарный диабет, недостаточность щитовидной железы.

Легкомысленное отношение к половым контактам и личной гигиене приводит к тому, что стрептококки начинают активно размножаться в половых путях под влиянием нарушенного биоценоза, при создании условий повышенной колонизации. Мазок в этом случае укажет на стрептококк как ведущий микроорганизм, что означает причину заболевания.

Антибактериальные препараты действуют не только в точке их приложения, но на любой микроорганизм. Поэтому прием антибиотиков во время лечения инфекционных заболеваний любой локализации необходимо прикрывать пребиотиками, пробиотиками, противогрибковыми средствами.

Попадание на слизистую возбудителей половых инфекций также приводит к нарушению местного иммунитета, дополнительному обсеменению стрептококками.


Чаще всего размножение стрептококка в мочеиспускательном канале у мужчин вызывает симптомы баланита и баланопостита. Головка полового члена воспалена, имеет гиперемированный вид. Крайняя плоть утолщена, отечна, на ней могут быть высыпания в виде мелкозернистых, красных пузырьков. Такие же папулёзные элементы покрывают слизистую полового органа.

Часто эти явления сопровождает симптом слипания отверстия уретры, что затрудняет мочеиспускание. Несоблюдение гигиенических процедур приводит к распространению заболевания на кожу промежности. Она может покрываться микротрещинами, зудеть, появляется чувство жжения в паху.

Обильные высыпания, раздражение сопровождается зудом, жжением не только на коже полового члена, но и по ходу уретры. Во время мочеиспускания больной чувствует боль, дискомфорт. Болевые ощущения могут распространяться на подвздошную область. Воспалительные заболевания мужской половой сферы стрептококковой природы редко сопровождаются симптомами общей интоксикации.

Скорее подобную клиническую картину могут показывать заболевания верхних дыхательных путей, которые вызывает стрептококк. Это связано с тем, что ангина, фарингит и другие подобные патологии дают возможность стрептококку дессеминировать с током крови и лимфы по организму.

При вышеуказанных заболеваниях, помимо местного воспалительного процесса, активно проявляют себя общая реакция организма:

  • высокая гипертермия;
  • слабость;
  • тошнота, потеря аппетита, рвота.

Наличие в организме очага хронической инфекции: тонзиллита, фарингита, синусита стрептококковой этиологии – весьма весомый фактор риска возникновения патологий других органов и систем. Особенно это актуально при ослаблении иммунитета, авитаминозах, серьезных соматических заболеваниях.

У детей стрептококковые инфекции мочеполовых путей возникают при отсутствии должного ухода, условий для личной гигиены. В группу риска попадают дети, которые часто лечатся в стационарах, где имеют возможность заразиться стрептококками – возбудителями внутрибольничных инфекций. Такие микроорганизмы обладают множественной устойчивостью к различным антибактериальным препаратам.


Стрептококк продолжает сохранять хорошую чувствительность к антибиотикам пенициллинового ряда. Однако, рекомендовано использовать для терапии инфекций половых органов комбинацию препаратов двух фармакологических групп. Предпочтение отдают аминогликозидам, макролидам, добавляя к ним показанный в таких случаях антибиотик пенициллиновой группы.

Другим терапевтическим направлением лечения является восстановление микрофлоры. Для этого необходимо назначение пребиотиков и пробиотических препаратов.

К пребиотикам относятся препараты, содержащие продукты жизнедеятельности полезных микроорганизмов, например, Хилак форте. Это необходимо для создания благоприятных условий размножения представителей полезной флоры, одновременно препятствия жизнедеятельности патологических микроорганизмов.

Пробиотики содержат микроорганизмы, заселяющие естественные локусы. Они способствуют нормализации водородного показателя рН слизистой оболочки органов мочеполовой системы, выработке витаминов группы В, препятствуют заселению кишечника и других биоценозов патогенными микроорганизмами. Это такие средства, как Линнекс, Лактовит форте.

Назначение нестероидных средств против воспаления поможет преодолеть симптомы общей интоксикации, явлений местного отека, покраснения. Мочеиспускание становится безболезненным, исчезает жжение или зуд.

Для скорейшего устранения местных явлений необходимо назначать ванночки с антимикробными препаратами, противовоспалительными отварами трав. Половые контакты должны отсутствовать на протяжении всего срока лечения. Это необходимо для обеспечения эффективности терапевтических мероприятий, также предохраняет от вторичного заражения.

Микрофлора неовлагалища, покрытого кожей полового члена, транссексуальных женщин | BMC Microbiology

Популяция пациентов

Для целей этого исследования 70 голландскоязычных транссексуальных женщин, у которых был минимальный интервал 6 месяцев с момента проведения SRS, которые консультировались с одним из членов гендерной группы для лечения или последующего наблюдения. до 2006 года были приглашены к участию. Через 4 недели наш целевой уровень участия 50 был достигнут, и никаких дальнейших усилий по увеличению размера выборки не предпринималось.

Процедуры исследования

Это исследование соответствует рекомендациям Хельсинкской декларации и было одобрено этическим комитетом нашего учреждения (университетская больница Гента) под номером 2006/375. После письменного и устного информированного согласия все женщины, согласившиеся на участие, завершили весь протокол исследования в период с марта по июнь 2007 года.

Пациентов проинструктировали избегать любых половых сношений и воздерживаться от использования средств гигиены влагалища (мыла, лосьонов и т. Д.) .) не менее чем за три дня до экзаменов.

При включении в исследование медсестра-исследовательница запросила следующие вопросы: медицинский и хирургический анамнез, сексуальная ориентация, статус текущих отношений и наличие частых эпизодов (определяемых как один раз в месяц или чаще) раздражения влагалища и / или дизурии. Все участники также заполнили обширные анкеты относительно общего, психического и сексуального здоровья, результаты которых были опубликованы ранее [21]. Был взят образец крови натощак для определения концентрации эстрадиола и тестостерона в сыворотке крови.

Осмотр зеркала проводил гинеколог. Исследование зеркала проводилось с использованием зеркала Коллинза длиной 10 см и шириной 2,5 см. Если введение этого зеркала считалось невозможным или если пациент указывал, что введение слишком болезненно, использовалось более тонкое (шириной 2 см) зеркало. Зеркало было минимально смазано несколькими каплями стерильной воды. Мы сознательно воздерживались от использования чего-либо, кроме стерильной воды, чтобы не мешать микрофлоре влагалища.Установив расширитель, ватный тампон наматывали на среднюю часть одной боковой стенки, чтобы получить мазок из влагалища. Затем тампон немедленно мазали по простому предметному стеклу и давали ему высохнуть при комнатной температуре. Второй стерильный тампон для посева и молекулярного анализа наматывали на ту же боковую стенку средней части влагалища, а затем помещали в жидкую транспортную среду Эмиса (Eswab, Nuova Aptaca, Canelli, Италия ) и обрабатывали в лаборатории. в течение 4 часов.Для оценки pH нового влагалища использовались две коммерческие (нитразиновые) pH-полоски: одна с диапазоном pH от 1 до 10 (с точностью до 1,0), а другая с диапазоном pH от 4 до 7 (с точностью до 0,1) ( Merck, Дармштадт, Германия ). Эти полоски прикладывали к стенке влагалища до достаточного увлажнения и сравнивали со стандартом производителя одним наблюдателем (SW). У одной пациентки установка зеркала была невозможна из-за почти полной облитерации влагалища.У этой пациентки все вагинальные мазки и pH-полоски были взяты поверхностно в точке «входа». Chlamydia определяли в образце мочи с использованием коммерческого ПЦР-анализа в реальном времени (Abbott RealTime CT, Abbott Laboratories, Иллинойс, США).

После завершения исследования у нас остались некоторые дополнительные вопросы, которые, по нашему мнению, могут иметь влияние на микрофлору влагалища. Поэтому пациенткам была отправлена ​​дополнительная анкета, в которой их спрашивали о регулярном использовании средств вагинальной гигиены (один раз в месяц или чаще) и о наличии неприятных выделений из влагалища (один раз в месяц или чаще).

Окрашивание слайдов

Мазки окрашивали по Граму (Mirastainer, Merck-Belgolabo, Overijse, Бельгия) и исследовали под масляной иммерсией при увеличении 1000 с помощью одного наблюдателя (ГХ).

Культивирование и идентификация культивируемых изолятов с помощью тДНК-ПЦР

Первым 30 женщинам 100 мкл жидкой транспортной среды Эми были нанесены штрихами на 5 различных чашек с агаром по прибытии в микробиологическую лабораторию. Культуральной средой для восстановления аэробных бактерий был триптический соевый агар с добавлением 5% овечьей крови (Becton Dickinson, Franklin Lakes, NJ).Стафилококки выделяли на солевом агаре с маннитолом (Becton Dickinson, Franklin Lakes, NJ). Обе среды инкубировали в аэробных условиях при 37 ° C в течение 24 часов. Культуральная среда для культивирования анаэробных бактерий представляла собой агар на основе Колумбии с 5% овечьей крови (Becton Dickinson, Franklin Lakes, NJ). Чашки с агаром MRS (Oxoid, Hampshire, UK) использовали для культивирования лактобацилл. Обе среды инкубировали в анаэробных условиях при 37 ° C в течение 5 дней на анаэробной рабочей станции (BugBox Plus, LedTechno, Heusden-Zolder, Бельгия).Чашки с селективным агаром GC-Lect (Becton Dickinson, Franklin Lakes, NJ) для выделения Neisseria gonorrhoeae инкубировали в атмосфере 5% CO 2 в течение двух дней. После инкубации для идентификации были отобраны все изоляты с разной морфологией колоний. ДНК экстрагировали простым щелочным лизисом: одну колонию суспендировали в 20 мкл лизирующего буфера (0,25% додецилсульфат натрия-0,05 н. NaOH), нагревали при 95 ° C в течение 15 минут и разбавляли 180 мкл дистиллированной воды. тДНК-ПЦР и капиллярный электрофорез проводили, как описано ранее [22, 23].Изоляты были идентифицированы путем сравнения их отпечатков пальцев тДНК-ПЦР с отпечатками из библиотеки отпечатков пальцев тДНК-ПЦР, полученными от эталонных штаммов, с использованием собственной программы [22]. Библиотека отпечатков тДНК-ПЦР доступна по адресу http://allserv.ugent.be/~mvaneech/All_C.txt, а программное обеспечение можно получить по запросу.


16S рРНК генов

Секвенирование проводили, как описано ранее [7], и последовательности сравнивали с последовательностями 16S рРНК, присутствующими в Genbank, с помощью BLAST.Последовательности, которые имели менее 98% сходства с ранее известными видами бактерий, были отправлены в Genbank и им были присвоены номера доступа FM0 – FM1.

Экстракция ДНК из образцов вагинальных мазков

Для экстракции ДНК из сухих вагинальных мазков 800 мкл буфера для лизиса NucliSens EasyMAG добавляли к 200 мкл жидкой транспортной среды Эмиса, инкубировали в течение 10 минут при комнатной температуре и хранили при -80 ° C до экстракции проводили на платформе NucliSens EasyMag (BioMérieux, Marcy l’Etoile, Франция) в соответствии с рекомендациями производителя.ДНК элюировали в 110 мкл буфера для элюции NucliSens EasyMAG, и ДНК-экстракты хранили при -20 ° C и использовали для целей ПЦР с точки зрения видоспецифичности.

Видоспецифическая ПЦР для

Gardnerella vaginalis

G. vaginalis видоспецифичные праймеры (G Z ), разработанные Zariffard et al. [24]. Вкратце, 20 мкл смеси для ПЦР содержали соответственно 0,05 мкМ праймеров, 10 мкл мастер-смеси Promega (Promega, Madison, WI), 2 мкл ДНК-экстракта Easymag образцов и дистиллированную воду.Термоциклирование с праймерами G Z состояло из начальной денатурации в течение 10 минут при 94 ° C, затем 50 циклов по 5 секунд при 94 ° C, 45 секунд при 55 ° C и 45 секунд при 72 ° C и заключительного продление 10 мин при 72 ° C. Пять мкл амплифицированного продукта визуализировали на 2% агарозном геле.

Видоспецифическая ПЦР для

Atopobium vaginae

Набор праймеров ato167f (5 ‘GCGAATATGGGAAAGCTCCG) и ato587r (5’ GAGCGGATAGGGGTTGAGC), который позволил специфическую амплификацию гена 16S рРНК A.vaginae использовали, как описано ранее [7].

Видоспецифическая ПЦР для BVAB

Видоспецифическая ПЦР для бактерий, ассоциированных с бактериальным вагинозом (BVAB1-3), была проведена, как описано ранее [17].

Специфическая ПЦР для


Родоспецифическая ПЦР для Mobiluncus spp. с использованием праймеров Mob-s 5’GTGAACTCCTTTTTCTCGTGAA и Mob-as 5’CGCAGAAACACAGGATTGCATCC и видоспецифической ПЦР для Mobiluncus curtisii с использованием праймеров Mob-V3 5’GCCAGCCTTCGGGGTGGTGT4 и др. [25] с небольшими изменениями. Вкратце, 20 мкл смеси для ПЦР содержали по 1 мкМ каждого из праймеров, 10 мкл MasterStart PCR master (Roche), 2 мкл ДНК-экстракта Easymag образцов и дистиллированную воду.

Термический цикл состоял из начальной денатурации в течение 2 минут при 94 ° C, за которыми следовали 35 циклов по 30 секунд при 94 ° C, 30 секунд при 60 ° C и 1 минута при 72 ° C, с последующим продлением 10 минут. при 72 ° C и охлаждении до 10 ° C.

Обнаружение и идентификация грибов с использованием анализа длины флуоресцентного фрагмента ITS2-PCR ампликона и секвенирования

Амплификацию ITS2-области и последующий капиллярный электрофорез выполняли, как описано ранее [26, 27].

Ампликоны, имеющие длину фрагмента, отсутствующую в существующей библиотеке ITS2, которая содержит большинство клинически важных видов дрожжей, секвенировали, как описано ранее [26].

Анализ данных

Распределения непрерывных и дискретных переменных были суммированы как средние и стандартные отклонения. Двумерные корреляции представлены коэффициентом R Пирсона, если наблюдаемое распределение приближается к нормальному распределению, либо коэффициентом ранговой корреляции Спирмена rho при непараметрическом предположении.

Статистическая значимость была принята на стандартном двустороннем уровне значимости α = 0,05. Все анализы были выполнены с помощью пакета статистических программ SPSS 15.0 (Чикаго, Иллинойс).

Диагностика вагинита — Американский семейный врач

1. Kent HL. Эпидемиология вагинита. Am J Obstet Gynecol . 1991; 165: 1168–76 ….

2. McCue JD. Оценка и лечение вагинита. Обновление для практикующих врачей первичного звена. Арк Интерн Мед. . 1989; 149: 565–8.

3. Карр ПЛ, Фельзенштейн Д., Фридман Р.Х. Оценка и лечение вагинита. Дж. Интерн. Мед. Наук . 1998. 13: 335–46.

4. Sobel JD. Вульвовагинит у здоровых женщин. Компр Тер . 1999; 25: 335–46.

5. Haefner HK. Текущая оценка и лечение вульвовагинита. Clin Obstet Gynecol . 1999; 42: 184–95.

6.Эшенбах Д.А., Hillier SL. Достижения в диагностике вагинитов и цервицитов. Дж Репрод Мед . 1989; 34: 555–64.

7. Шааф В.М., Perez-Stable EJ, Борхардт К. Ограниченное значение симптомов и признаков в диагностике вагинальных инфекций. Арк Интерн Мед. . 1990; 150: 1929–33.

8. Sobel JD. Вагинит. N Engl J Med . 1997; 337: 1896–903.

9. Берг АО, Гейдрих Ф.Е., Файн С.Д., Бергман Дж. Дж., Древесина RW, Штамм МЫ, и другие.Установление причины мочеполовых симптомов у женщин в семейной практике. Сравнение клинического обследования и комплексной микробиологии. ЯМА . 1984; 251: 620–5.

10. Горовиц Б.Дж., Джакинта Д., Ито С. Развивающиеся патогены кандидозного вульвовагинита: значение для ухода за пациентами. Дж. Клин Фармакол . 1992; 32: 248–55.

11. Hill GB. Микробиология бактериального вагиноза. Am J Obstet Gynecol .1993. 169: 450–4.

12. Сено ЧП. Рецидивирующий бактериальный вагиноз. Дерматол Клин . 1998; 16: 769–73, xii – xiii.

13. Собель Дж. Бактериальный вагиноз. Бр. Дж. Клиническая Практика Инфекция . 1990; 71 (доп.): 65–9.

14. Hill LH, Рупарелия H, Эмбиль Я. Неспецифический вагинит и другие генитальные инфекции в трех клинических группах. Секс-трансмиссия . 1983; 10: 114–8.

15. Отбойник RC, Buesching WJ 3d.Бактериальный вагиноз у девственных и сексуально активных девушек-подростков: доказательства против исключительно половой передачи. Am J Obstet Gynecol . 1988. 158: 935–9.

16. Барбоне Ф, Остин Х, Жалюзи WC, Александр WJ. Последующее исследование методов контрацепции, сексуальной активности и показателей трихомониаза, кандидоза и бактериального вагиноза. Am J Obstet Gynecol . 1990; 163: 510–4.

17. Haukkamaa M, Странден П., Jousimies-Somer H, Сийтонен А.Бактериальная флора шейки матки у женщин, использующих разные методы контрацепции. Am J Obstet Gynecol . 1986; 154: 520–4.

18. Сено ЧП, Ламонт РФ, Тейлор-Робинсон Д, Морган диджей, Изон С, Пирсон Дж. Аномальная бактериальная колонизация половых путей и последующие преждевременные роды и поздний выкидыш. BMJ . 1994; 308: 295–8.

19. Hillier SL, Ньюджент РП, Эшенбах Д.А., Крон М.А., Гиббс Р.С., Мартин Д.Х., и другие.Связь между бактериальным вагинозом и преждевременными родами ребенка с низкой массой тела при рождении. Группа изучения вагинальных инфекций и недоношенности. N Engl J Med . 1995; 333: 1737–42.

20. Hauth JC, Гольденберг Р.Л., Эндрюс В. В., ДюБард МБ, Купер Р.Л. Снижение частоты преждевременных родов при приеме метронидазола и эритромицина у женщин с бактериальным вагинозом. N Engl J Med . 1995; 333: 1732–6.

21.Monif GR. Классификация и патогенез кандидозного вульвовагинита. Am J Obstet Gynecol . 1985; 152: 935–9.

22. Елтаббах Г.Х., Елтаббах Г.Д., Broekhuizen FF, Гринер БТ. Значение мокрого образца и посевов шейки матки во время цитологического исследования шейки матки у бессимптомных женщин. Акушерский гинекол . 1995; 85: 499–503.

23. Soper DE, Броквелл MJ, Далтон HP, Джонсон Д. Наблюдения за микробной этиологией острого сальпингита. Am J Obstet Gynecol . 1994; 170: 1008–14.

24. Корн А.П., Болан Г, Падиан Н, Ом-Смит М, Schachter J, Landers DV. Плазменно-клеточный эндометрит у женщин с симптоматическим бактериальным вагинозом. Акушерский гинекол . 1995; 85: 387–90.

25. Фоксман Б. Эпидемиология кандидозного вульвовагинита: факторы риска. Am J Общественное здравоохранение . 1990; 80: 329–31.

26. Sobel JD. Кандидозный вульвовагинит. Clin Obstet Gynecol . 1993; 36: 153–65.

27. Гейгер А.М., Фоксман Б. Факторы риска кандидозного вульвовагинита: исследование методом случай-контроль среди студентов университетов. Эпидемиология . 1996; 7: 182–7.

28. Собель Ю.Д., Фаро С, Force RW, Фоксман Б, Ledger WJ, Nyirjesy PR, и другие. Вульвовагинальный кандидоз: эпидемиологические, диагностические и терапевтические соображения. Am J Obstet Gynecol .1998. 178: 203–11.

29. Spinillo A, Капуццо Э, Никола С, Балтаро Ф, Феррари А, Монако А. Влияние оральной контрацепции на кандидозный вульвовагинит. Контрацепция . 1995; 51: 293–7.

30. Hooton TM, Робертс П.Л., Штамм МЫ. Влияние недавней половой жизни и использования диафрагмы на микрофлору влагалища. Клин Инфекция Дис . 1994; 19: 274–8.

31. Скиннер CJ, Стоукс Дж. Кирлев Y, Кавана Дж., Forster GE.Случай-контролируемое исследование потребностей лесбиянок в сексуальном здоровье. Генитурин Мед . 1996. 72: 277–80.

32. Eckert LO, Hawes SE, Стивенс CE, Коутский Л.А., Эшенбах Д.А., Холмс К.К. Вульвовагинальный кандидоз: клинические проявления, факторы риска, алгоритм лечения. Акушерский гинекол . 1998. 92: 757–65.

33. Spinillo A, Капуццо Э, Acciano S, Де Сантоло А, Зара Ф.Влияние использования антибиотиков на распространенность симптоматического вульвовагинального кандидоза. Am J Obstet Gynecol . 1999; 180: 14–7.

34. Коттедж МФ, Хиллиер С.Л., Гиббс Р.С., Эшенбах Д.А. Эпидемиология и исходы, связанные с умеренной и тяжелой колонизацией Candida во время беременности. Группа изучения вагинальных инфекций и недоношенности. Am J Obstet Gynecol . 1998. 178: 374–80.

35. Пагано Р. Синдром вульварного вестибулита: часто нераспознаваемая причина диспареунии. Aust N Z J Obstet Gynaecol . 1999; 39: 79–83.

36. Руководство 1998 г. по лечению болезней, передающихся половым путем. Центры по контролю и профилактике заболеваний. MMWR Morb Mortal Wkly Rep . 1998; 47: 1–111.

37. Sobel JD. Патогенез и лечение рецидивирующего кандидозного вульвовагинита. Клин Инфекция Дис . 1992; 14 (приложение 1): S148–53.

38. Lossick JG, Kent HL. Трихомониаз: тенденции в диагностике и лечении. Am J Obstet Gynecol . 1991; 165: 1217–22.

39. Петрин Д, Дельгати К, Бхатт Р., Гарбер Г. Клинико-микробиологические аспекты Trichomonas vaginalis. Clin Microbiol Ред. . 1998. 11: 300–17.

40. Лага М, Манока АТ, Кивуву М, Малеле Б, Тулиза М, Нзила Н, и другие. Неязвенные заболевания, передаваемые половым путем, как факторы риска передачи ВИЧ-1 у женщин: результаты когортного исследования. СПИД . 1993; 7: 95–102.

41. Коттедж МФ, Pastorek JG 2d, Ньюджент РП, Йерг Д.Е., Мартин Д.Х., Эшенбах Д.А. Демографические и поведенческие предикторы инфекции Trichomonas vaginalis среди беременных. Группа изучения вагинальных инфекций и недоношенных акушерских гинекол . 1991; 78: 1087–92.

42. Hammill HA. Trichomonas vaginalis. Акушерская гинекологическая клиника North Am . 1989; 16: 531–40.

43. Рейли Б.М. Практические стратегии в амбулаторной медицине. 2-е изд. Филадельфия: Сондерс, 1991: 1016–46.

44. Handsfield HH, Ясман Л.Л., Робертс П.Л., Hanson V W, Kothenbeutel RL, Штамм МЫ. Критерии выборочного обследования на инфекцию Chlamydia trachomatis у женщин, посещающих клиники планирования семьи. ЯМА . 1986; 255: 1730–4.

45. Krieger JN, Там MR, Стивенс CE, Нильсен И.О., Хейл Дж, Кивиат Н.Б., и другие.Диагностика трихомониаза. Сравнение обычного влажного исследования с цитологическими исследованиями, посевами и окрашиванием прямых образцов моноклональными антителами. ЯМА . 1988. 259: 1223–7.

46. Амсель Р, Тоттен PA, Spiegel CA, Чен KC, Эшенбах D, Холмс К.К. Неспецифический вагинит. Диагностические критерии и микробно-эпидемиологические ассоциации. Ам Дж. Мед. . 1983; 74: 14–22.

47.Томасон Дж. Л., Гельбарт С.М., Андерсон Р.Дж., Уолт АК, Осиповский П.Я., Broekhuizen FF. Статистическая оценка диагностических критериев бактериального вагиноза. Am J Obstet Gynecol . 1990; 162: 155–60.

48. Крон М.А., Хиллиер С.Л., Эшенбах Д.А. Сравнение методов диагностики бактериального вагиноза у беременных. Дж. Клин Микробиол . 1989; 27: 1266–71.

49. Технический бюллетень ACOG.Вагинит. Номер 226 — июль 1996 г. (заменяет № 221, март 1996 г.). Комитет технических бюллетеней Американского колледжа акушеров и гинекологов. Int J Gynaecol Obstet . 1996; 54: 293–302.

50. Нугент РП, Крон М.А., Hillier SL. Надежность диагностики бактериального вагиноза повышается за счет стандартизированного метода интерпретации окраски по Граму. Дж. Клин Микробиол . 1991; 29: 297–301.

51. Spiegel CA, Амсель Р, Холмс К.К.Диагностика бактериального вагиноза методом прямого окрашивания по Граму влагалищной жидкости. Дж. Клин Микробиол . 1983; 18: 170–7.

52. Мацзулли Т, Симор А.Е., Низкая DE. Воспроизводимость интерпретации мазков из влагалища, окрашенных по Граму, для диагностики бактериального вагиноза. Дж. Клин Микробиол . 1990; 28: 1506–8.

53. Sobel JD. Патофизиология кандидозного вульвовагинита. Дж Репрод Мед . 1989; 34: 572–9.

54.DeMeo LR, Дрейпер Д.Л., МакГрегор Дж. А., Мур Д.Ф., Питер ЧР, Каперник П.С., и другие. Оценка зонда дезоксирибонуклеиновой кислоты для обнаружения Trichomonas vaginalis во влагалищном секрете. Am J Obstet Gynecol . 1996; 174: 1339–42.

55. Joesoef MR, Шмид Г.П., Hillier SL. Бактериальный вагиноз: обзор вариантов лечения и потенциальных клинических показаний к терапии. Клин Инфекция Дис .1999; 28 (приложение 1): S57–65.

56. Йованович Р., Конгема E, Nguyen HT. Противогрибковые препараты против борной кислоты для лечения хронического грибкового вульвовагинита. Дж Репрод Мед . 1991; 36: 593–7.

57. Руководство 1998 г. по лечению болезней, передающихся половым путем. Получено 19 июня 2000 г. из Интернета: http://www.cdc.gov/nchstp/dstd/1998_STD_Guidelines/1998_guidelines_for_the_treatment.htm.

Молекулярное обнаружение видов Lactobacillus в неовлагалище транссексуальных женщин от мужчины к женщине

Это обсервационное исследование было проведено после одобрения этического комитета Венского медицинского университета (EK 982/2010) в соответствии с Хельсинкской декларацией. и руководящие принципы надлежащей клинической практики.Информированное согласие было получено от всех участников исследования до включения в исследование.

Мы наблюдали транссексуальных женщин-транссексуалов без аномальных выделений из влагалища, клинических признаков инфекции, новообразований или кровотечений, которые были набраны на постоянной основе из числа транссексуальных амбулаторных пациентов Венского медицинского университета во время стандартных плановых контрольных осмотров. Женщины-транссексуалы с диареей, запорами, патологиями прямой кишки, включая геморрой, или инфекциями мочевыводящих путей, а также пациенты, получавшие антибактериальную терапию в предыдущие 4 недели, или пациенты, принимавшие вагинальные пробиотики, были исключены из исследования.Все участники перенесли операцию по смене пола (SRS) с использованием техники перевернутого кожного лоскута полового члена 10 по крайней мере за 1 год до включения в исследование. Все женщины-транссексуалы лечились в соответствии со Стандартами ухода Всемирной профессиональной ассоциации здоровья трансгендеров (WPATH) 11 .

У каждого участника был взят мазок с обеих боковых стенок неовлагалища, перенесен на транспортную среду (Copan Innovation Italy) и отправлен в Венский университет природных ресурсов и наук о жизни для дальнейшей обработки.Мазки исследовали путем молекулярного профилирования лактобацилл с использованием метода ПЦР-ДГГЭ. Полосы с паттерном миграции, отличным от полос маркеров, вырезали с последующей повторной амплификацией и секвенированием.

Исследование вагинальных мазков

Клетки каждого мазка суспендировали в 1 мл стерильного фосфатно-солевого буфера (PBS) в течение 1 минуты, и суспензию непосредственно использовали для экстракции бактериальной ДНК.

Штаммы бактерий и условия роста

Для получения маркерной лестницы в анализе ПЦР-DGGE была использована ДНК следующих штаммов бактериального типа: L.plantarum (ATCC 14917), L. johnsonii (ATCC 33200), L. gasseri (ATCC 33323), L. jensenii (ATCC 25258), L. crispatus (ATCC 33820), L. salivarius subsp. salivarius (ATCC 11741), L. paracasei subsp. paracasei (ATCC 25302) и L. vaginalis (ATCC 49540). Лактобациллы выращивали анаэробно (80% N 2 , 10% CO 2 , 10% H 2 ) в бульоне MRS (Merck, Дармштадт, Германия) при 37 ° C. L. iners (LMG 19913) культивировали на чашках с колумбийским кровяным агаром (PB0123, Oxoid, Wesel, Германия) в микроаэрофильных условиях (GENbag microaer *, Biomérieux, Marcy l’Etoile, Франция) и в течение 72 ч при 37 ° C. .

Экстракция ДНК

Набор peqGOLD Bacterial DNA Kit (peqlab, Erlangen, Germany) использовали для экстракции бактериальной ДНК. Согласно инструкциям для грамположительных бактерий, ДНК экстрагировали из ночных культур лактобацилл и суспензий мазков, описанных выше.

Денатурирующий градиентный гель-электрофорез (DGGE)

Внутри выделенной ДНК специфическая область гена 16S рРНК была амплифицирована путем применения комбинации праймеров Lac1-f: 5′-AGCAGTAGGGAATCTTCCA-3 ‘и Lac2r: 5’-ATTYCACCGCTACACATG 3 ′ 12 . GC-зажим (5′-CGC CCG GGG CGC GCC CCG GGC GGC CCG GGG GCA CCG GGG G -3 ‘) присоединяли к 5’-концу обратного праймера для разделения с помощью денатурирующего градиентного гель-электрофореза. Реакции ПЦР проводили в Mastercycler (Eppendorf, Гамбург, Германия) в 0.Формат реакционных пробирок 2 мл. Каждая реакционная смесь для ПЦР состояла из 10 мкл ДНК-матрицы, 1 мкл праймера Lac1-f и Lac2r (10 пмоль / мкл для Lac1-f, 12,5 пмоль / мкл для Lac2r), (Eurofins MWG Operon, Эберсберг, Германия) 2,5 мкл 10x Буфер для ПЦР (Finnzymes, Эспоо, Финляндия), 0,5 мкл dNTP (10 мМ, Carl Roth, Карлсруэ, Германия), 0,5 мкл ДНК-полимеразы Dynazyme (2 Ед / мкл; Finnzymes, Эспоо, Финляндия) и 9,5 мкл стерильной воды. Программа амплификации составляла 95 ° C в течение 4 минут, 35 циклов при 95 ° C в течение 30 секунд, 61 ° C в течение 40 секунд, 72 ° C в течение 1 минуты и заключительный этап элонгации при 72 ° C в течение 5 минут.Универсальная система обнаружения мутаций DCode ™ (BioRad, Мюнхен, Германия) применялась для DGGE в соответствии с инструкциями производителя. Для электрофореза использовали 8% -ный полиакриламидный гель (37,5: 1 акриламид-бисакриламид, Serva, Гейдельберг, Германия) с денатурирующим градиентом 35–55%, образованным мочевиной и формамидом. Гели запускали в 1x буфере TAE при 60 ° C и 70 В в течение 16 часов. Разделенные полосы визуализировали окрашиванием бромистым этидием, идентифицировали путем сравнения рисунка полос с лестницей, состоящей из полос, происходящих от чистых штаммов типа Lactobacillus , и документировали цифровой фотографией (BioRad Gel Doc XR +).

Анализ последовательности ДНК

Полосы DGGE, которые отличались от DGGE-маркера, примененного для идентификации, вырезали из геля DGGE с помощью чистого скальпеля и инкубировали в течение ночи в 1x буфере для ПЦР при 4 ° C. Следующая амплификация была проведена с использованием праймеров Lac1-f и Lac-2r (без GC-clamp) 12 . Полученные продукты ПЦР очищали с помощью набора PCRExtract Mini Kit (5 Prime GmbH, Гамбург, Германия) и секвенировали (Eurofins MWG Operon, Ebersberg, Германия). Последовательности анализировали с помощью инструмента BLASTn (http: // blast.ncbi.nlm.nih.gov). Минимальная идентичность последовательностей 98% была выбрана в качестве критерия для идентификации видов.


Поскольку это первое исследование изоляции лактобацилл у транссексуальных женщин, исторических оценок для расчета размера выборки не было. Мы включили всех пациентов, соответствующих критериям включения, в течение одного года. Демографическая и справочная информация обобщается и отображается с использованием методов описательной статистики.

Основной показатель результата

Основным критерием результата было обнаруженное на молекулярном уровне разнообразие видов Lactobacillus в неовлагалище женщин-транссексуалов, переходящих от мужчины к женщине, включая виды, которые трудно культивировать.

Инфекционный вагинит | GLOWM


Выделения из влагалища в основном состоят из воды с электролитами, микроорганизмами, эпителиальными клетками и органическими соединениями, такими как жирные кислоты, белки и углеводы. 19 Влагалищную жидкость в основном получают из транссудата сыворотки влагалищного ложа, который просачивается из капилляров через межклеточные каналы. Меньшее количество жидкости поступает из бартолиновых желез, шейки матки, эндометрия и маточных труб.Клеточные элементы представляют собой отшелушенные клетки столбчатого эпителия шейки матки и плоскоклеточного эпителия влагалища. Лейкоциты присутствуют только в небольшом количестве среди женщин без вагинита. 20

Эстроген и pH — два важных фактора, которые влияют на типы бактерий, присутствующих во влагалищной флоре. Содержание молочной кислоты во влагалище обеспечивает кислый рН менее 4,5 у взрослых женщин. Молочная кислота вырабатывается в результате метаболизма Lactobacillus и эпителиальными клетками влагалища путем расщепления гликогена.Низкий pH способствует росту ацидофильных организмов, таких как Lactobacillus , но подавляет рост большинства других бактерий. Lactobacillus занимает центральное место в ограничении роста других бактерий. 6 Lactobacillus также способны продуцировать H 2 O 2 , 21 , который подавляет рост бактерий, не содержащих каталазу. Комбинация галогенид-иона, такого как хлорид, в изобилии присутствующего во влагалище, с пероксидазой, присутствующей в эндометрии и влагалищной жидкости, 22 и H 2 O 2 , продуцируемых некоторыми штаммами Lactobacillus , образует мощную ингибирующую систему для некоторых бактерий во влагалище 23 и ВИЧ и других вирусов in vitro . 9

Нормальные вагинальные микроорганизмы

Из влагалища женщин можно выделить от 5 до 10 микроорганизмов, и основное внимание уделяется количеству восстановленных бактерий. Большинство исследований не контролировали наличие BV или «промежуточной» флоры на основе окрашивания по Граму, 24 и, в зависимости от популяции, значительный и широкий круг людей страдает такими вагинальными состояниями. 25

Таблица 1 описывает частоту и концентрацию микроорганизмов, выделенных культивированием из влагалища беременных женщин, стратифицированных по критериям окраски по Граму. 24 Lactobacillus видов было выделено из 96% нормальной группы. 23 Исходя из средней log концентрации, Lactobacillus присутствовала в концентрации, в 10 раз большей, на log 10 7 уровнях, чем концентрация следующего микроорганизма, Gardnerella vaginalis , присутствующая при log 10 6 уровни примерно у половины пациентов. 23 Lactobacillus присутствовала в концентрации от 90 до 100 раз выше, чем у следующих по численности микроорганизмов, видов Enterococcus и Ureaplasma urealyticum .Для половины женщин без G. vaginalis , Lactobacillus видов составляли 98% или более от фактического количества микроорганизмов, а у женщин с G. vaginalis , Lactobacillus составляли около 90% от общего числа микроорганизмов. количество микроорганизмов во влагалище людей с нормальными результатами окрашивания по Граму и Lactobacillus — доминирующей флорой. По этим результатам можно оценить полное доминирование видов Lactobacillus во влагалище женщин с нормальной флорой влагалища.В этой нормальной флоре только от 1% до 5% концентрации составляют потенциально патогенные аэробные бактерии и микоплазмы, такие как Staphylococcus aureus , стрептококки группы B, E. coli или некоторые из потенциально патогенных анаэробов.

ТАБЛИЦА 1. Частота и логарифмическая концентрация выбранных микроорганизмов во влагалище, стратифицированных по образцу пятен по Граму


4905.1 )

(10 4.1 )

9495 КОЕ / мл

Частота (логарифмическая концентрация)




(n = 39)




Всего Lactobacillu с

96 (10 7.0 )

85 (10 6,6 )

67 (10 6,3 )


H 2 -34 O 2

61 (10 7,2 )

40 (10 6,5 )



64 9005 Gardne 6.0 )

79 (10 6,5 )

92 (10 7,7 )


Стрептококки группы В )

17 (10 4,1 )

21 (10 5,8 )


Escherichia coli

15 (10 3,0 )

21 (10 4,6 )


Mycoplasma hominis4 )

38 (10 4,8 )

61 (10 5,2 )


Уреаплазма уреалитик

91 (10 5 )

92 (10 5 )


Анаэробный грамотрицательный стержень

91 (10 4,3 )

89 (10 5,0 )

100 (10 6,0000 99)

> 10 5 КОЕ / мл





68 (10 4,6 )

77 (10 5,5 )


> 10 5 CFU / мл




Bacteroides ureolyticus

36 (10 3 405 905 9055 )

59 (10 4.0 )


Mobiluncus sp.






2.9 )

21 (10 3.8 )


Peptostreptococcus sp.

91 (10 8,2 )

91 (10 4,9 )

90 (10 5,3 )






Candida albicans



КОЕ / мл, колониеобразующая единица на миллилитр вагинальной жидкости; БВ, бактериальный вагиноз.
Данные Hillier SL, Krohn MA, Rabe LK et al. Нормальная микрофлора влагалища, H 2 O 2 -продуцирующих лактобациллы и бактериальный вагиноз у беременных. Clin Infect Dis 1993; 16 (Дополнение 4): S273.

Распространенность Lactobacillus значительно снижается в случаях BV, в которых виды Lactobacillus больше не являются доминирующими микроорганизмами.В БВ концентрация G . vaginalis (присутствует у 92% пациентов) обнаруживается при средней логарифмической концентрации 10 7,7 . 23 При БВ распространенность Lactobacillus снижается, H 2 O 2 -положительных Lactobacillus практически исчезает, а концентрация анаэробных грамотрицательных палочек и видов Prevotella увеличивается. С BV Lactobacillus составляет 1% или менее от количества присутствующих бактерий (Таблица 1).

Женщины в этом отчете с промежуточной флорой имели одинаковую распространенность и концентрацию Lactobacillus и G . vaginalis , а около 10% остальных микроорганизмов составили Enterococcus , U . urealyticum и анаэробные грамотрицательные палочки. 23 Ожидается, что хирургическая процедура, зараженная подавляющим большинством непатогенных Lactobacillus , вызовет значительно меньшую инфекцию, чем хирургическая процедура, в которой существуют более высокие концентрации патогенных бактерий.

Механизмы вагинальной инфекции

При изменении сложного баланса микроорганизмов потенциально патогенные эндогенные микроорганизмы, которые являются частью нормальной флоры, такие как Candida albicans в случае кандидоза и G. vaginalis и анаэробные бактерии в случае BV, размножаются до концентрации, вызывающей симптомы. Мало что известно о факторах, способствующих разрастанию нормальной флоры. Патогенные экзогенные микроорганизмы, передающиеся половым путем, такие как Trichomonas vaginalis , N.gonorrhoeae и C. trachomatis также могут вызывать инфекцию.


Диагностика вагинита не может основываться исключительно на наличии или отсутствии симптомов. У женщин с вагинитом встречается широкий спектр симптомов, который во многом перекликается с симптомами, которые возникают у женщин без инфекции или вагинита. Для постановки диагноза вагинита врачи должны использовать физические и лабораторные параметры, а не симптомы. За исключением некоторых людей с типичными и четко выраженными симптомами кандидоза, самодиагностика еще более неточна. 3

Диагноз вагинита в значительной степени основывается на микроскопических критериях. При обнаружении трихомонад, ключевых клеток или гиф специфичность составляет практически 100%. Однако чувствительность определения любой из этих трех микроскопических особенностей с помощью влажного крепления составляет всего около 80% в идеальных условиях 26 и намного ниже при рецидивирующем кандидозе и у неопытных микроскопистов. Синдромальный диагноз и лечение неточны и неприемлемы ни в одном современном медицинском учреждении.Если диагноз не может быть установлен с уверенностью, через несколько дней следует провести отобранные культуры и повторное обследование, по крайней мере, женщинам с симптомами и подозрением на вагинит для постановки конкретного диагноза и женщинам с симптомами и предполагаемыми нормальными выделениями для дальнейшего исключения вагинита. Два обследования с нормальными результатами теоретически повышают диагностическую точность в обеих категориях до 96% (80% + [0,80 × 20%]). Использование повторного обследования снижает склонность врача исключать вагинит после одного «нормального обследования» у женщин с симптомами инфекции и может дать уверенность женщинам с симптомами и при нормальных результатах обоих обследований об отсутствии инфекции.


Внешний вид вульвы

Вульву следует обследовать на предмет географической эритемы или трещин, которые могут возникать при кандидозе и контактном дерматите, на наличие белого эпителия склероза лишайников, гипертрофического эпителия при нейродермитах ( например бородавок, кист, рака). Тонкие выделения из влагалища часто присутствуют во входе в рот у женщин с трихомониазом или БВ. Пациентов с чрезмерной болезненностью вульвы следует тщательно обследовать на предмет вестибулита, особенно если они испытывают боль при проникновении во время полового акта.При вестибулите вестибулярная область на отметках 4 и 8 часов вне гименального кольца обычно красная и болезненная даже при легком прикосновении. 27

Появление выделений из влагалища

Нормальные выделения из влагалища обычно белые и комковатые, и они скапливаются во влагалище. Напротив, выделения из BV серые и однородные (, т.е. водянистый вид обезжиренного молока), и они присутствуют на передней и боковой стенках влагалища. 20 Candida может вызвать «творожный» налет на стенке влагалища, 4 и трихомониаз часто вызывает гнойные выделения. 28 Характеристики выделений из влагалища достаточно разные, чтобы их можно было использовать при первоначальной классификации (рис. 1). Однако, как правило, конкретный диагноз не может быть поставлен только по внешнему виду выделений, поскольку у большинства пациентов нет «типичного» внешнего вида.

Рис. 1. Характеристики выделений из влагалища.

Вид шейки матки

Во время ранней фазы менструального цикла с преобладанием эстрогена прозрачные слизистые эндоцервикальные выделения являются нормальным явлением.В более поздней прогестероновой фазе цикла цервикальная слизь густая, скудная или незаметная. Выделения из влагалища на эктоцервиксе необходимо удалить с шейки матки ватным тампоном, чтобы проверить наличие гнойных выделений из влагалища. Наличие гнойного отделяемого в эндоцервикальном канале должно указывать на диагноз цервицита. N . gonorrhoeae и C . trachomatis присутствуют примерно у половины женщин с цервицитом. 18 При цервиците может возникнуть эндоцервикальное кровотечение при мазке с шейки матки из-за чрезмерной рыхлости столбчатого эпителия.

Офисный анализ


Простой офисный анализ влагалищных выделений полезен и недорого. Результаты позволяют отнести пациентов к одной из двух основных диагностических категорий: нормальные выделения / кандидоз, если pH нормальный, или BV / трихомониаз / десквамативный вагинит, если pH повышен (рис. 1). Индикатор pH должен иметь диапазон от 4 до 6.Уровень pH следует проверить, поместив каплю влагалищных выделений на pH-бумагу или потерев ею стенку влагалища. Следует избегать цервикальной слизи, поскольку она имеет щелочной pH. Нормальный pH практически исключает BV.


Капля 10% гидроксида калия (КОН), смешанная с нормальной вагинальной жидкостью, на предметном стекле не производит запаха. 29 Рыбный запах триметиламина встречается у женщин с БВ и у многих женщин с трихомониазом. Запах рыбы вызван улетучиванием в основном триметиламина, который является побочным продуктом анаэробного метаболизма.

Микроскопический анализ

Отношение влагалищных выделений к нормальному физиологическому раствору приблизительно 1: 4 смешивают на предметном стекле и покрывают покровным стеклом, чтобы получить влажную мазку физиологического раствора. Смешивают влагалищные выделения с большим соотношением 2: 1 к 10% КОН, ощущают запах амина, и образец покрывают покровным стеклом, чтобы получить влажный образец КОН. Микроскопическое исследование следует проводить в течение нескольких минут после подготовки слайда. На основании предыдущего внешнего вида и химических определений ищется наиболее вероятная характеристика, которую можно идентифицировать с помощью микроскопии (рис.1). Наиболее вероятным признаком у пациентов с pH 4,5 и отсутствием запаха амина является Lactobacillus , что свидетельствует о нормальной флоре или гифах у пациентов с кандидозом. Напротив, микроскописты должны искать ключевые клетки, трихомонады, морфотипы мелких бактерий и лейкоциты (лейкоциты) у пациентов с pH> 4,5 и запахом амина. Систематический анализ нескольких микроскопических особенностей — ключ к точному диагнозу.


Несколько лейкоцитов могут присутствовать во влагалище в результате физиологических выделений из шейки матки, особенно в предменструальный период, но их количество обычно не превышает количества вагинальных эпителиальных клеток.Большое количество лейкоцитов указывает на трихомониаз, цервицит или, иногда, на кандидоз. Женщины с десквамативным воспалительным вагинитом (DIV) также имеют большое количество лейкоцитов.


Выделения женщин с кандидозом или нормальными выделениями обычно содержат преобладание больших палочек, которые при окрашивании являются грамположительными. Эти большие стержни можно увидеть на препарате для влажного крепления и представляют лактобациллы. Их количество обычно уменьшается или они отсутствуют у пациентов с BV, трихомонадной инфекцией или DIV.


В отличие от пациентов с нормальной флорой Lactobacillus , пациенты с BV, трихомональной инфекцией и DIV обычно имеют преобладание кокков или малых коккобациллярных форм и отсутствуют или имеют лишь несколько морфотипов Lactobacillus . Эти мелкие бактерии особенно многочисленны при БВ.


Трихомонады — это подвижные жгутиковые микроорганизмы, которые немного больше лейкоцитов. Полностью подвижные трихомонады легко идентифицировать по характерным волнообразным плавательным движениям.Однако лейкоциты часто препятствуют их подвижности, и примерно у 20% женщин с трихомониазом подвижные трихомонады не наблюдаются при низком 100-кратном увеличении, но бьющиеся жгутики могут быть обнаружены на стационарных трихомонадах при 400-кратном увеличении. Около половины женщин с трихомониазом при посеве имеют слишком мало трихомонад, чтобы их можно было обнаружить с помощью прямой микроскопии. К счастью, у большинства этих пациентов симптомы отсутствуют.


Ключ-ключ — это вагинальная эпителиальная клетка, к которой прикрепляется такое большое количество бактерий, что граница клетки не видна и имеет зубчатый вид.Ячейки-подсказки наиболее объективно идентифицируются, наблюдая за отсутствием прямой границы ячеек через объектив 400x. У женщин с БВ от 5% до 50% вагинальных эпителиальных клеток являются ключевыми клетками.


Гифы идентифицируются на влажном держателе 10% КОН. Гифы имеют характерный вид ветвления, который обычно можно определить с помощью 100-кратного объектива. Следует сканировать всю поверхность покровного стекла, потому что даже у женщин с симптомами гифы могут скучиваться только в одной области стекла.Почки дрожжей также могут определить опытные микроскописты.


Для выявления лейкоцитов, преобладающей бактериальной флоры и дрожжевых форм вместо влажного образца можно использовать окраску по вагинальному Граму. Окрашивание по Граму бесполезно для обнаружения трихомонад. У пациентов с БВ преобладает флора мелких грамотрицательных бацилл (, например, Gardnerella spp., Анаэробы) и относительно отсутствует крупная грамположительная палочка (, например, морфотипы Lactobacillus ).Окрашивание по Граму полезно для выявления нормальной, промежуточной флоры и флоры BV. 24 Окрашивание по Граму более чувствительно, чем влажное крепление, для идентификации Candida .

Вагинальные культуры

Вагинальные бактериальные культуры имеют ограниченную пользу для диагностики вагинита. Культуры следует использовать только в определенных обстоятельствах. Цервикальные анализы на N. gonorrhoeae и C. trachomatis должны быть получены у любой женщины с гнойным экссудатом шейки матки. Гонорейные и хламидийные инфекции также распространены среди женщин с трихомониазом.Тесты на обнаружение ДНК (, т.е. полимеразная цепная реакция или лигазная цепная реакция) являются наиболее чувствительными и доступными. 30

Вагинальные посевы на микроорганизмов Candida полезны для женщин с подозрением на кандидоз, но с нормальными результатами подготовки КОН. Посевы Candida должны быть получены от женщин без гиф в мазке КОН, у которых есть зуд, эритематозная сыпь вульвы, трещины вульвы или белые бляшки вульвы, а также у женщин, не реагирующих на противогрибковые препараты.

Культуры трихомонад на среде Даймонда можно получить при гнойных выделениях из влагалища, когда повторные микроскопические исследования не позволяют идентифицировать организм. Мокрые мазки выявляют только от 50% до 70% бессимптомных женщин с трихомониазом. 31 Однако эти культуры не всегда доступны во многих клинических условиях.

Влагалищные посевы на G. vaginalis , другие нормальные бактерии вагинальной флоры или генитальные микоплазмы практически не помогают диагностировать вагинит. G. vaginalis выделены примерно у 50% бессимптомных женщин без вагинита, поэтому их наличие плохо коррелирует с вагинитом и БВ.


Около 10% женщин с жалобами на выделения из влагалища имеют физиологическое увеличение количества нормальной цервикальной слизи или нормального экссудата влагалищной жидкости. У женщин с физиологическими выделениями обычно отсутствуют аномалии вульвы и белые хлопьевидные (комковатые) выделения из влагалища. Выделения очень густые и имеют тенденцию скапливаться в нижней части влагалища.Поверхности эпителия влагалища и шейки матки имеют нормальный розовый цвет. Уровень pH нормального слива обычно составляет менее 4,5, и при нанесении KOH запаха амина отсутствует (рис. 1). Наиболее поразительной находкой под микроскопом является обилие вагинальных эпителиальных клеток и больших палочек, представляющих нормальные грамположительные лактобациллы (рис. 1). Никаких «подсказок», трихомонад или мицелия не видно, и только несколько лейкоцитов и короткостержневых бактерий присутствуют при микроскопии.

Цервикальная слизь может вызывать обильные выделения, особенно у женщин с большой площадью поверхности столбчатого эпителия шейки матки.У таких женщин обычно бывают чрезмерные выделения в середине цикла. Осмотр шейки матки в середине цикла выявляет большое количество прозрачной цервикальной слизи и, как правило, большую площадь цилиндрического эпителия. Окраска по Граму выделений из шейки матки выявляет только единичные лейкоциты. У этих женщин выделения из влагалища под микроскопом выглядят так же, как физиологические выделения из влагалища. Необходимо провести анализы на цервикальные гонококки и хламидии, чтобы исключить их присутствие.

Женщины с физиологическими выделениями должны быть уверены, что выделения нормальные и что терапия не требуется.Пациенты с симптомами, которые все еще подозревают, что у них инфекционный вагинит, должны быть повторно обследованы через 1-2 недели. Следует избегать длительного использования тампонов, чтобы предотвратить изъязвление влагалища. Хотя такая практика обычно не приветствуется, некоторые женщины настаивают на спринцевании, и в этом случае следует использовать мягкий раствор уксуса или воду. Тем не менее, многократное высушивание многократных спринцеваний может увеличить количество выделений, а спринцевание коммерческими препаратами может вызвать аномальные изменения во влагалищной флоре. 32 Спринцевание не рекомендуется из-за его связи с сальпингитом. 33 Антимикробные схемы не следует назначать женщинам с физиологическими выделениями из влагалища из-за их неэффективности, склонности вызывать кандидоз, стоимости и, что наиболее важно, потому, что их неспособность устранить симптомы создает ненужные опасения. Криокаутеризация, лазерное прижигание, электрическое прижигание и обработка нормального столбчатого эпителия нитратом серебра обычно не требуется при чрезмерных нормальных выделениях из шейки матки.


Candida albicans вызывает от 80% до 90% вагинальных грибковых инфекций, а другие виды Candida и Torulopsis вызывают остальные. 34 Эти сапрофитные грибы могут быть изолированы в небольшом количестве от 5% до 20% бессимптомных женщин. Симптомы обычно возникают только тогда, когда эти организмы размножаются в больших количествах.


Истинная заболеваемость кандидозным вульвовагинитом неизвестна. Женщины-носители C . albicans в половых путях может протекать бессимптомно или иметь симптомы сильного воспаления. Симптомы отражают иммунный ответ хозяина. Диагноз без использования микроскопии или посева показывает, что у половины женщин с диагнозом кандидоз вместо этого есть другие заболевания. 1 К студенческому возрасту около половины женщин имеют один эпизод кандидоза, диагностированный врачом. 35 Кандидоз увеличивается после менархе, что частично связано с началом половой жизни. 36 , 37 Частота кандидоза увеличивается во время беременности. Женщины в постменопаузе, получающие заместительную терапию эстрогенами, могут иметь кандидоз.

Частота половых контактов связана с кандидозом. 36 , 37 Число половых партнеров 36 и орально-генитальный контакт 37 не увеличивает заболеваемость кандидозом. Кандидоз, по-видимому, слабо связан с противозачаточными таблетками с высокими дозами эстрогена. 38 Половой акт с использованием спермицида ноноксинола-9, по-видимому, увеличивает колонизацию Candida. 39 Спринцевание коммерческими продуктами, по-видимому, временно изменяет флору влагалища 32 и периодически было связано с рецидивирующей инфекцией Candida . 36 , 37

Антибиотики сильно связаны с кандидозом, 40 , и эта связь может быть особенно важна для женщин с рецидивирующей инфекцией. 41 Неясно, убивают ли антибиотики бактерии, такие как Lactobacillus , которые могут подавлять рост Candida , или используют другие механизмы. 6

Диета может мало играть роль кандидоза. 42 Гигиенические практики, включая частое опорожнение кишечника, направление вытирания после опорожнения кишечника, тип защиты от менструации, ткань нижнего белья и тесная одежда, по-видимому, не играют роли при кандидозе. 37 Иммуносупрессия ВИЧ-инфекции связана с C . torulopsis инфекция 34 и повышенная частота пищеводного и, возможно, вагинального C . albicans инфекция. Неконтролируемый диабет связан с кандидозом, особенно с нечувствительными инфекциями.


Рецидивы типичных тяжелых симптомов, таких как зуд и раздражение вульвы, часто представляют собой кандидоз, но примерно в половине случаев самостоятельно диагностируются атипичные или минимальные симптомы. 43 Помимо обнаружения низкого pH и ранее обсужденных результатов микроскопии, необходимы культуры для женщин с подозрением на кандидоз, у которых результаты микроскопии на Candida отрицательны.Среди женщин с положительной культурой и симптомами наружной дизурии, зуда, отека или покраснения вульвы тест на влажный тест КОН был положительным только около 60%, в результате чего 30% женщин не были диагностированы с помощью КОН. 4

Неосложненный кандидоз относится к спорадическим нечастым эпизодам с легкими или умеренными симптомами у нормальной небеременной женщины. Практически все неосложненные инфекции вызываются C . Альбиканс . Осложненный кандидоз — это рецидивирующая инфекция, инфекция с тяжелыми симптомами или инфекция у беременных, диабетических женщин или женщин с ослабленным иммунитетом.Многие случаи осложненной инфекции вызываются видами, отличными от albicans, видов.



Местная терапия азолами остается препаратом первого выбора для лечения нечастого острого кандидоза. Азолы обладают фунгистатическим действием, поскольку они ингибируют синтез эргостерина (и мембран). Candida Организмы уничтожаются лимфоцитами хозяина посредством клеточно-опосредованных иммунных механизмов. Только ограниченный фунгицидный эффект может быть достигнут за счет высокой концентрации азолов, вызывающих прямое повреждение мембран.Азолы для местного применения эффективны, хорошо переносятся и относительно недороги. Доступные продукты включают буконазол (Фемстат), клотримазол (Гин-Лотримин, Мицелекс), миконазол (Монистат) и терконазол (Теразол). Доступен широкий диапазон доз в форме кремов и суппозиториев (Таблица 2). Для некоторых препаратов интервал лечения был увеличен до двух раз в день или доза была увеличена со 100 до 200 мг, в то время как продолжительность лечения была сокращена с 7 до 3 дней. Показатели излечения для 3-дневного курса были равны более длительным курсам для неосложненного кандидоза.Показатели краткосрочного (7–30-дневного) излечения при использовании азолов для местного применения в течение 3–7 дней обычно составляют от 80% до более 90%. Нет никаких предположений о том, что скорость излечения различается для разных азолов или между суппозиторием и кремом.

ТАБЛИЦА 2. Рекомендованные схемы лечения вульвовагинальным кандидозом азолом


905azole -мг суппозитории HS


0.4% крем hs


Интравагинальная доза


2% крем hs

3 дня

Клотримазол (Gyne-Lotrimin, Mycelex)

100-мг таблетки






100 мг таблетки hs

7 дней

1% крем HS

7 дней

3 дня

Суппозитории 100 мс hs

7 дней

Терконазол (теразол)

Суппозитории 80 мг

0 905

7 дней


Таблетка 150 мг

1 доза

Я не рекомендую однократную терапию что однодневные курсы менее эффективны, чем указывают опубликованные отчеты. Частично это можно объяснить тенденцией включать в исследования женщин с легкими краткосрочными симптомами и без предшествующего кандидоза.Обычно сообщается только о краткосрочных (от 7 до 30 дней) показателях клинического излечения, а более высокая частота микологических неудач происходит через 30 дней, когда пациентам вводят однократную дозу, по сравнению с более длительным курсом терапии. 44 Однако нет уверенности в том, что повышенная скорость выздоровления Candida после лечения связана с увеличением частоты последующего клинического кандидоза, и продолжительность терапии может иметь меньшее значение при неосложненной спорадической инфекции, чем в случаях осложненной инфекции. .

Пероральный азол флуконазол делает пероральные препараты безопасным выбором при вагинальном кандидозе. Одноразовая пероральная доза 150 мг эффективна для пациентов с легкими или умеренными симптомами. 45 Этот препарат стал популярным среди пациентов, потому что вагинальный крем не используется, и среди врачей, потому что краткосрочное применение не оказывает токсического воздействия на печень, проблема, которая помешала широкому использованию кетоконазола. Однако для очень симптоматических пациентов дозу часто необходимо повторять через 4–5 дней из-за высокой частоты неудач, которая в противном случае превышает частоту неудач местной терапии. 45 Врачам необходимо знать о лекарственном взаимодействии между флуконазолом и антигистаминными препаратами, которые удлиняют интервал QTc, пероральными гипогликемическими средствами, кумадином и другими лекарственными средствами (см. Справочник лекарств). 46 Среди пациентов без иммуносупрессии широкое использование, вероятно, не приводит к устойчивости.

Местная полиеновая терапия, состоящая из нистатина, в значительной степени была заменена местным лечением азолом. Нистатин хорошо переносится и стоит недорого, но процент излечения от 50% до 80% ниже, чем у азолов.Нистатин — препарат второй линии для лечения неосложненного кандидоза.

Капсулы с борной кислотой (600 мг или порошок борной кислоты в желатиновых капсулах 0 размера), вставляемые дважды в день в течение 14 дней, обеспечивают клиническую эффективность, аналогичную азолам для местного применения. 47 Ион бора в крови не обнаружен, 48 борная кислота недорогая и хорошо переносится. Однако борная кислота может вызвать язвы пищевода при непреднамеренном проглатывании, и препарат следует хранить во флаконах с защитными крышками, в запираемой аптечке и использовать с осторожностью, когда маленькие дети находятся в доме.Из-за недоказанной безопасности для плода борную кислоту нельзя использовать во время беременности. Лечение генцианвиолетом эффективно для лечения кандидоза, но окрашивание одежды и кожи ограничивает его использование в редких случаях, когда не поддаются лечению другие лекарства. Сорбат калия и повидон-йод имеют ограниченную эффективность против кандидоза.

Местное Candida Терапия обычно хорошо переносится, а реакции необычны. Если во время использования возникает повышенное раздражение влагалища, лечение следует немедленно прекратить и заменить на другой препарат.Большинство этих раздражений возникает в результате реакции на «неактивные» соединения в кремовом носителе.


Пациенты, у которых симптомы вернулись через несколько дней после завершения курса лечения, обычно принимали только короткий курс или не соблюдали его. Часто бывает достаточно более длительного курса или другой подготовки. Устойчивость Candida к противогрибковым препаратам встречается редко, а у некоторых пациентов с постоянными симптомами наблюдаются другие заболевания. Пациенты с быстрым рецидивом должны иметь документально подтвержденный кандидоз с помощью мокрого образца КОН, посева или того и другого.Пациенты без объективных свидетельств Candida , но со стойкими симптомами должны быть обследованы на предмет вагинита или вульвита, вызванного другими состояниями. Следует учитывать нейродермит, красный плоский лишай, склероз лихена, синдром жжения вульвы и незначительное воспаление вестибулярных желез.

У небольшого числа пациентов с лекарственной устойчивостью обычно наблюдается уменьшение симптомов во время терапии, но быстрое повторение симптомов после прекращения приема лекарств. C. albicans почти одинаково чувствителен ко всем азолам.Однако устойчивость к азолам чаще встречается среди необычных грибов, таких как Candida glabrata, Candida tropicalis или других видов Candida , не относящихся к albicans, 49 , и при наличии этих грибов следует учитывать возможную устойчивость. Можно попробовать лечение терконазолом, поскольку он обладает большей активностью, чем другие азолы, против C. glabrata и C. tropicalis . Пациентов можно перевести на ноназольные препараты, нистатин или борную кислоту. Борная кислота более эффективна, чем флуконазол, для лечения вульвовагинального кандидоза, отличного от albicans . 49 , 50 Терапия генцианвиолетом также может принести пользу. В редких случаях ни одно из местных лекарств не эффективно для устранения вагинальных грибков, и нистатин или борную кислоту необходимо вводить каждые 2–3 дня на неопределенный срок, чтобы подавить, а не устранить резистентные грибки.

Неудачи лечения кандидоза были настолько редкими, что систематические исследования для определения причин неудач лечения не проводились. Период наблюдения был слишком коротким (30 дней или меньше), чтобы точно оценить частоту неудач.Были упомянуты несоблюдение рекомендаций, псевдонарушения из-за реакции на носитель и устойчивость к лекарствам. Две другие известные теории неудач лечения требуют обсуждения.

Первая теория гласит, что рецидивирующий вагинальный кандидоз возникает из желудочно-кишечного тракта. Candida. Микроорганизмы Candida чаще встречаются в полости рта и желудочно-кишечном тракте пациентов с кандидозом, чем в контрольной группе. 51 Однако большинство пациентов переносят Candida в желудочно-кишечном тракте без развития вагинального кандидоза, и в долгосрочных исследованиях вагинальный кандидоз не был связан с желудочно-кишечным кандидозом Candida. Пероральная терапия нистатином дала смешанные результаты. Пероральный нистатин не оказал заметного эффекта, хотя небольшое статистически значимое снижение последующего вульвовагинита Candida произошло в группе, получавшей пероральный нистатин, по сравнению с плацебо. 52 Употребление 4 унций йогурта, содержащего лактобациллы, два раза в день также обеспечило умеренное сокращение рецидивов. 53

Вторая теория предполагает передачу рецидивирующего кандидоза половым путем.Половые партнеры-мужчины у пациенток с вагинальным кандидозом имеют более высокий уровень колонизации гениталий, чем в контрольной группе. 54 Передача половым путем, вероятно, действительно происходит у небольшого числа (по оценкам, от 10% до 15%) мужчин, у которых наблюдается баланит Candida , сочетающийся с вагинальным кандидозом их партнера. Однако только 20% половых партнеров-мужчин колонизированы Candida, и лечение мужчин не уменьшило вагинальный кандидоз у женщин. Большинство мужчин выглядят пассивно колонизированными самками, а не играют главную роль в рецидивирующем вагинальном кандидозе.


Временное уменьшение симптомов вульвы происходит с помощью сидячей ванны с последующим пересушиванием кожи феном при низкой температуре. Кремы с азолом для местного применения также могут быть прописаны для непосредственного использования вульвы, но информации об их эффективности мало.

Диета для снижения высокого уровня углеводов оказалась полезной для части пациентов, у которых развился кандидоз вскоре после приема необычно большого количества сахара.Среди диабетиков лечение кандидоза обычно не приносит успеха, пока уровень глюкозы не контролируется. Популяризуется отказ от продуктов, приготовленных из дрожжей, но научных данных об их эффективности нет. Дрожжевые организмы в пище — это не те виды, которые вызывают вагинит. Дрожжи, вызывающие вагинит, настолько распространены в окружающей среде и на коже, что трудно поверить, что бездрожжевая диета влияет на вагинальный кандидоз. Прекращение антибактериальной терапии может быть рассмотрено, когда это возможно, у небольшого числа пациентов, постоянно принимающих противомикробные препараты.Прекращение приема оральных контрацептивов спорно и, вероятно, имеет ограниченную пользу. Отказ от тесной, плохо вентилируемой одежды, вероятно, принесет мало пользы.


Значительная часть пациентов была идентифицирована с хроническими или часто рецидивирующими (не менее четырех раз в год) эпизодами вагинального кандидоза. Эти пациенты составляют значительное число пациенток с вагинальным кандидозом, посещающих определенные клиники.

Неясно, имеют ли пациенты с хроническим рецидивирующим кандидозом ограниченный иммунологический дефект, при котором лимфоциты не убивают микроорганизмы Candida во влагалище, или другие причины рецидива.Рецидив не связан с необычными или устойчивыми к лекарствам штаммами Candida , и лишь немногие пациенты страдают диабетом или принимают оральные контрацептивы, иммунодепрессанты или антибиотики. Женщин с частыми рецидивами вагинального кандидоза или кандидоза, которые не поддаются лечению, следует рассмотреть для прохождения тестирования на ВИЧ. Однако немногие женщины с рецидивирующим кандидозом имеют ВИЧ или какой-либо другой общепризнанный фактор, предрасполагающий пациентов к кандидозу.

Симптоматическое заболевание часто трудно поддается лечению, но важным прорывом стала хроническая супрессивная терапия, аналогичная той, которая используется при инфекциях мочевыводящих путей.В первоначальном исследовании использовалась терапевтическая доза 400 мг перорального кетоконазола в течение 14 дней с последующей поддерживающей дозой в течение 6 месяцев. 55 Потенциальная токсичность для печени и затраты ограничивают использование кетоконазола, и теперь 14-дневный режим должен включать флуконазол, вводимый каждые 4 дня, или вагинальный азол. В контролируемом исследовании частота рецидивов кетоконазола через 6 месяцев составила 70% для тех, кто принимал плацебо, и 5% для тех, кто принимал кетоконазол ежедневно. 55 Практические поддерживающие схемы включают местное введение азола раз в две или в неделю. 56 Аналогичные результаты достигаются при пероральном применении итраконазола или флуконазола в качестве поддерживающей борной кислоты или местного применения. 57 Рецидив вагинального кандидоза может возобновиться с той же скоростью, что и до подавления после прекращения поддерживающей терапии. 55


Системная абсорбция азолов или нистатина из влагалища настолько ограничена, что их можно безопасно использовать в течение всех триместров беременности. Борная кислота, флуконазол, итраконазол и кетоконазол не следует применять во время беременности.По сравнению с небеременными женщинами кандидоз во время беременности более устойчив к лечению, с большей вероятностью рецидивирует и лучше реагирует на 7- или даже 14-дневную терапию по сравнению с 1-3-дневной терапией.


T. vaginalis — это повсеместный анаэробный паразит, передающийся половым путем. T. vaginalis был связан с вагинитом, атипичными цитологическими мазками и другими инфекциями, передаваемыми половым путем. До половины женщин, больных гонореей, также страдают трихомониазом. 58 Воспаление, вызванное Trichomonas , может увеличить передачу ВИЧ в два-три раза. 59 По оценкам, во всем мире инфицировано 200 миллионов человек. С 1970-х годов в США наблюдается постепенное сокращение числа людей, пролеченных от трихомониаза, 60 , возможно, связанных с лечением БВ метронидазолом. Однако только у 50% женщин с трихомонадами есть симптомы. 61

T. vaginalis передается исключительно половым путем.Организм существует во влагалище, уретре, мочевом пузыре, а также во бартолиновых и скеновых железах. Инфекция чаще всего встречается у молодых сексуально активных женщин, особенно с новым партнером. 7 Хотя трихомонозная инфекция встречается у студентов колледжей нечасто, ее вылечили более 12% беременных городских женщин, в основном женщин с низким социально-экономическим статусом. 62 Более двух третей женщин и до 60% мужчин болеют трихомониазом, когда их половой партнер был признан инфицированным. 63 , 64 Значительное число мужчин переносят этот организм в течение длительного времени, хотя некоторые мужчины излечиваются без лечения.Мужчины, контактировавшие с мужчинами, с большей вероятностью являются носителями трихомонад, если они будут обследованы в течение 6 дней после их последнего контакта, но 33% контактировавших с ними мужчин были носителями трихомонад через 6–60 дней после последнего контакта. 65 Этот микроорганизм присутствовал в 14-60% мужчин, контактировавших с женщинами с трихомониазом в 19 исследованиях, что подтверждает передачу половым путем и необходимость лечения партнеров-мужчин. 66

T. vaginalis вызывает клеточный и гуморальный иммунный ответ.Однако эти реакции не защищают от повторного заражения, которое является обычным явлением. Полиморфно-ядерный лейкоцитарный ответ на T. vaginalis часто бывает интенсивным и связан с количеством организмов. 67


Женщины с симптомами обычно жалуются на обильные, зловонные и часто неприятные выделения из влагалища, которые вызывают внутреннюю и внешнюю дизурию. 28 Также может присутствовать ощущение полноты вульвы и влагалища и болезненность в нижней части живота.Симптомы обычно обостряются во время менструации.

При осмотре вульва может быть слегка эритематозной и отечной. Вульва и влагалище могут быть покрыты зелеными или желтыми гнойными, пенистыми и пахнущими выделениями. 28 Классические выделения встречаются примерно у трети женщин. Небольшие участки субэпителиальной гиперемии влагалища и шейки матки обычно требуют кольпоскопии для идентификации, но иногда эти участки выявляются на эпителии шейки матки ( i.е. клубника шейки матки) невооруженным глазом. Эта находка характерна для трихомониаза. 28 , 67

У женщин с трихомониазом часто встречается инфекция, передающаяся половым путем. Сопутствующая болезненность слизистой шейки матки, матки и живота часто обнаруживается у женщин с трихомониазом, и если эти признаки присутствуют, женщинам необходимо пройти обследование на наличие других инфекций, таких как гонорея и хламидиоз. Однако T. vaginalis нечасто выделяется из маточных труб женщин с сальпингитом и, по-видимому, не вызывает инфекции верхних половых путей у небеременных женщин.Исключение может быть во время беременности, поскольку повышенный риск преждевременных родов у женщин с трихомониазом возникает на сроке от 23 до 26 недель беременности независимо от других половых инфекций. 68

Диагноз трихомониаза ставится на основании лабораторных исследований. У женщин с трихомониазом часто наблюдается повышенный уровень pH влагалища, запах амина и колонизация видов Gardnerella и Bacteroides . 25 В клинической практике инфекция обычно проявляется при обнаружении подвижных трихомонад в выделениях из влагалища с помощью микроскопии влажного солевого раствора. 31 Различные пятна трихомонад на препарате предметного стекла обычно менее чувствительны, чем влажный образец, и хотя метод полимеразной цепной реакции более чувствителен, чем влажный образец, 69 он слишком дорог для повседневного использования. Сообщения о наличии трихомонад в мазках Папаниколау (Пап) должны требовать подтверждения с использованием мокрого образца или посева из-за высокого уровня ложноположительных результатов при идентификации мазков Папаниколау. 31 Посевы следует проводить только женщинам с неустановленными хроническими симптомами и отрицательным результатом мокрого исследования.Посевы выявляют на 50% больше женщин с трихомониазом, чем только мокрый анализ. 31 Около половины женщин с трихомониазом имеют низкую концентрацию микроорганизмов, но, к счастью, у большинства этих женщин симптомы отсутствуют или отсутствуют. Культуры полезны в исследовательских целях, и средства массовой информации Даймонда работают лучше, чем другие средства массовой информации. 70


Метронидазол, 5′-нитроимдиазол, является единственным эффективным лекарством, одобренным для лечения трихомониаза в США.Пероральная терапия обеспечивает адекватный уровень лекарств при вагинальных, периуретральных, уретральных инфекциях и инфекциях мочевого пузыря. T. vaginalis содержит ферредоксины, белки с низким окислительно-восстановительным потенциалом, которые играют важную роль в метаболизме анаэробных микроорганизмов, таких как T. vaginalis . 5′-нитроимидазолы для уничтожения требуют восстановления нитрогруппы, которая окисляет ДНК, вызывая повреждение ДНК и последующую гибель клеток. Аэробные условия мешают этому процессу восстановления и снижают эффективность метронидазола. 71 T. vaginalis обычно чувствителен к метронидазолу при концентрации менее 1 мкг / мл в анаэробных условиях, но при более высоких концентрациях в аэробных условиях. 71 Метронидазол в разовой дозе 2 г дает пиковые уровни в сыворотке 40 мкг / мл. Период полувыведения метронидазола из сыворотки крови составляет около 8 часов. 72 Результаты лечения обычно отражают восприимчивость in vitro, , 73 и необычный пациент, который не проходит лечение стандартными дозами метронидазола, имеют повышенную устойчивость к метронидазолу in vitro . 74

Рекомендуемое лечение состоит из 2 г метронидазола в виде стандартной разовой дозы или 500 мг метронидазола два раза в день в течение 7 дней (таблица 3). Наиболее часто изучалась схема приема 250 г трижды в день в течение 7 дней, но период полувыведения метронидазола поддерживает использование режима дозы 500 мг два раза в день. Поскольку статический и 7-дневный режимы одинаково эффективны для лечения неосложненного трихомониаза, статическая доза является предпочтительной из-за большей комплаентности по сравнению с 7-дневным режимом.Показатели излечения выше 95% обычно отмечаются при использовании любого режима, 75 , особенно когда лечение получают также половые партнеры-мужчины. 76

ТАБЛИЦА 3. Рекомендованные схемы лечения трихомониаза

Неосложненная инфекция

Доза метронидазола



2 г


Однократная доза

Альтернатива или 9685000



, 2 раза в день в течение 7 дней

Документально подтвержденная неудача лечения

1 г


2 раза в день на 7 — 14 дней

9000 500 мг


9 0499

два раза в день в течение 7 — 14 дней

* Полового партнера необходимо одновременно лечить.

Тошнота, наиболее частый побочный эффект, возникает примерно у 10% пациентов после приема однократной дозы 2 г. 75 Металлический привкус, головная боль, головокружение и темная моча также возникают при использовании метронидазола. Пациентам следует рекомендовать воздерживаться от употребления алкоголя в течение 24 часов после приема последней дозы метронидазола из-за дисульфирамоподобного эффекта, вызывающего тошноту при одновременном приеме алкоголя. Метронидазол может продлить тромбиновое время у людей, принимающих кумадин. 77

Мутагены были обнаружены в моче женщин, принимающих метронидазол.Метронидазол канцерогенен для животных, 78 , и его следует рассматривать как слабый канцероген, способный вызывать повреждение ДНК, что вызывает опасения по поводу увеличения заболеваемости раком среди бывших потребителей метронидазола. Два относительно небольших ретроспективных исследования не показали связи между метронидазолом и раком. 79 , 80 Частота некоторых видов рака среди пользователей метронидазола была немного выше по сравнению с контрольной группой, хотя с относительными рисками менее 2.Однако исследования слишком малы, чтобы выявить эффект при повышении риска менее чем в два раза, а слабые канцерогены часто связаны с коэффициентом риска ниже 2. Данные также неполны из-за короткого периода наблюдения по сравнению с периодом наблюдения до 30 лет. латентный период клинического рака. Врачи не должны забывать о возможном канцерогенном эффекте метронидазола.


Рекомендуется сопутствующая терапия мужского полового партнера для предотвращения повторного заражения.Мужчины часто могут сопротивляться терапии, потому что обычно они протекают бессимптомно. Показатели излечения женщин увеличиваются на 10–25%, если лечить также мужчин. Сообщалось о 97% излеченности при приеме 2 г и 7-дневном режиме, когда заключенных женщин лечили без повторного контакта с партнерами-мужчинами. 81 , 82 Мужская терапия также снижает распространение трихомонадной инфекции среди других женщин.


Бессимптомным женщинам, у которых обнаружен трихомониаз, следует предложить терапию для снижения риска передачи половым путем.Терапию также следует назначать пациентам с атипичными воспалительными мазками Папаниколау и T. vaginalis.


Возможное нарушение режима лечения следует искать у пациентов, которые первоначально получали 7-дневный режим. Поскольку пациенты со стойким трихомониазом также могут иметь повторное инфицирование, им и их партнерам следует повторно назначить 7-дневный режим. Показатели излечения после повторного лечения остаются высокими при стандартных схемах лечения.

Клиническая резистентность Т.vaginalis к метронидазолу сообщается у небольшого числа пациентов даже после двух-трехкратного приема обычной дозы препарата. 74 Существует общая корреляция между восприимчивостью in vitro к и показателями клинического излечения, но клиническая и лабораторная эффективность не коррелируют так же для T. vaginalis , как и при тестировании на чувствительность к бактериям. Тем не менее, средняя восприимчивость in vitro для T. vaginalis у женщин, устойчивых к стандартной терапии метронидазолом, была примерно в восемь раз выше, чем восприимчивость стандартных изолятов. 74

Пациенты, которые не реагируют на обычные дозы метронидазола, соблюдают режим лечения и не подвергались повторному контакту с партнерами-мужчинами, должны получать лечение с увеличенной дозой и продолжительностью приема препарата. Эти случаи были нечастыми, и единой схемы лечения не установлено. Один из режимов, который, по моему мнению, оказался полезным, представлен в Таблице 3. В целом пациенты, у которых стандартная терапия неэффективна, отвечали на ежедневную пероральную дозу 2 г метронидазола с интравагинальной дозой 1000 мг метронидазола в течение 7-14 дней.Большинство пациентов испытывают сильную тошноту при ежедневном приеме 3 г или более метронидазола, но обычно они могут завершить лечение. Внутривенное введение использовалось для клинически устойчивых случаев, 83 , но этот режим дорог, токсичен и, вероятно, не нужен, поскольку пероральный метронидазол хорошо всасывается. Если требуются высокие дозы метронидазола, следует проконсультироваться со специалистом по инфекционным заболеваниям. Ежедневное введение от 4 до 6 г или более метронидазола было связано с судорогами и возможностью вывести из строя периферическую невропатию. 84

Тинидазол с более длительным периодом полувыведения, чем метронидазол, также использовался для лечения резистентного трихомониаза 85 в обычной дозе в течение вдвое большей продолжительности. Однако тинидазол недоступен в США. Сообщалось, что местный клотримазол лечит трихомониаз, 86 , но клинический опыт свидетельствует о низком уровне излечения. Другие препараты, которые следует учитывать пациентам с резистентным трихомониазом или пациентам с аллергией на метронидазол, включают местный 6% парамицин 87 и ноноксинол-9. 88


Лечение трихомониаза метронидазолом во время беременности является спорным вопросом. Несмотря на ассоциацию T. vaginalis с недоношенными, 68 существует мало свидетельств того, что микроорганизм проникает в матку или плаценту. Лечение во время беременности оправдано при появлении симптомов, но не для уменьшения недоношенности. Метронидазол вводили большому количеству беременных женщин, и для небольшого числа беременных женщин, по которым имеются данные об исходах, метронидазол не был связан с признанными тератогенными или другими неблагоприятными неонатальными эффектами. 89 Однако метронидазол обладает мутагенным и канцерогенным потенциалом, и, хотя степень этих эффектов не определена, есть основания для разумного использования метронидазола во время беременности.

При беременности возможно несколько модификаций терапии. Следует избегать лечения в первом триместре, когда новорожденный наиболее чувствителен к действию лекарств, и его следует назначать пациентам с умеренными или тяжелыми симптомами во втором и третьем триместре. Клотримазол может временно уменьшить симптомы, хотя излечение происходит редко.Бессимптомные пациенты или пациенты с минимальными симптомами не должны получать лечение во время беременности, но они могут получить 2 г метронидазола в день родов. Уровни препарата в грудном молоке равны уровням в сыворотке крови, и кормление грудью можно отложить на 24 часа, чтобы ограничить уровни, присутствующие в грудном молоке.


BV является наиболее частой причиной вагинальных инфекций. БВ, по-видимому, вызывает инфекцию верхних отделов половых путей, что контрастирует с другими формами вагинита, и эта черта еще раз подтверждает важность БВ.Причина BV далеко не ясна. БВ может быть вызван чрезмерным ростом определенных бактерий во влагалище, но он также может быть вызван неспособностью Lactobacillus обеспечить ингибирующий контроль над другой вагинальной флорой. Конечным результатом является чрезмерный рост потенциально вирулентных микроорганизмов во влагалище, что вызывает усиление выделений и запаха из влагалища, а также увеличение инфекции верхних половых путей.

БВ является обычным явлением в большинстве популяций, но распространенность БВ зависит от популяции.Это, по-видимому, особенно распространено в клиниках по лечению заболеваний, передающихся половым путем (ЗППП), в отличие от клиник по планированию семьи или женских консультаций; среди женщин с жалобами на выделения из влагалища; в более низких социально-экономических (особенно афроамериканских) группах; и в Африке к югу от Сахары. Распространенность БВ колеблется от 4% у бессимптомных студентов университетов до 15-25% среди невыбранных пациентов, посещающих гинекологические клиники, и от 30% до 60% в популяциях ЗППП. 90 В Уганде 51% из почти 5000 сельских женщин имели БВ. 91 Во время беременности распространенность БВ составляет от 12% до 20%, 14 , 92 , и эти цифры показывают диапазон БВ у молодых сексуально активных женщин в США.


Роль передачи половым путем в развитии БВ неясна. В первоначальных исследованиях прививка инфицированных выделений из влагалища от женщин с БВ у добровольцев вызвала заболевание, 16 , но прививка G. vaginalis , выращенного в лаборатории, не вызвала БВ. 93 G. vaginalis обычно выделяется из уретры мужчин половых партнеров женщин с БВ. 16 , 94 В проспективных когортных исследованиях новый или несколько половых партнеров повышали риск развития БВ. 7 , 95 , 96 Конкордантность БВ у лесбийских пар также предполагает передачу половым путем. 97 Однако существуют скудные данные о другой микрофлоре мужской уретры в сексуальных контрактах женщин с БВ, а передаваемые микроорганизмы не идентифицированы.Лечение половых партнеров-мужчин женщин с БВ не повлияло на последующее развитие БВ у женщины. 98 , 99 , 100

Возможно, что какой-то другой косвенный микробный механизм, связанный с половым актом, приводит к BV. Например, ингибирование Lactobacillus спермой или другими бактериями, не участвующими непосредственно в BV во время полового акта, также может вызывать BV, устраняя контролирующее влияние Lactobacillus .Отсутствие организмов, продуцирующих H 2 O 2 Lactobacillus и отсутствие Lactobacillus , было фактором приобретения BV. 7 Другие факторы, нарушающие флору влагалища, такие как использование внутриматочной спирали 95 , 101 и спринцевание 7 , по-видимому, увеличивают риск БВ. Недавнее использование антибиотиков, 7 , 95 использование противозачаточных средств, 7 и возраст не были связаны с БВ, хотя гормональные факторы могут играть роль, поскольку БВ в основном поражает женщин репродуктивного возраста. 102


Нормальная микрофлора влагалища состоит преимущественно из видов Lactobacillus , которые составляют от 90% до 95% от общего числа бактерий. 23 Lactobacillus присутствует в концентрациях от 10 5 до 10 8 колониеобразующих единиц / мл у женщин с нормальным вагинальным окрашиванием по Граму, 23 и у большинства женщин с доминантной флорой Lactobacillus H 2 O 2 -продуцирующие Lactobacillus . 21 , 23 В отличие от женщин с доминирующей флорой Lactobacillus , одна треть женщин с BV не имеют Lactobacillus , а у остальных более низкие концентрации обычно не-H 2 O 2 — продуцирующие Lactobacillus . 21 , 23 У женщин с БВ частота и концентрация повышаются на G . vaginalis , отобранные грамотрицательные палочковые анаэробные бактерии, видов Mobiluncus и Mycoplasma hominis . 23 , 101 , 103 , 104 У женщин с БВ концентрация G . vaginalis увеличивается в 20-100 раз, а грамотрицательные анаэробы и M . hominis в 20-100 раз по сравнению с таковыми с доминирующей флорой Lactobacillus . 23 , 105 В сочетании с высокими концентрациями G . vaginalis и анаэробы, Lactobacillus исчезают или концентрация Lactobacillus снижается примерно в 10 раз в BV. 23 , 105 Это увеличение концентрации потенциально вирулентной флоры, вероятно, объясняет, почему BV связан с инфекцией верхних половых органов. В других условиях инфекция напрямую связана с концентрацией вирулентных микроорганизмов. Способность этих бактерий вторгаться в условиях BV, вероятно, усиливается за счет продукции нескольких молекул посредством бактериального метаболизма, включая сиалидазу 106 и протеазу, которая может усиливать инвазивные свойства, способность подавлять иммунную резистентность с помощью сукцината, 107 и расщепление секреторного IgA некоторыми штаммами G.vaginalis 108 и, вероятно, другими механизмами.

Большинство женщин с доминирующей флорой Lactobacillus имеют лактобациллы, продуцирующие H 2 O 2 , которые могут подавлять многие бактерии, особенно каталазонегативные бактерии, у которых нет фермента, выводящего токсины H 2 O 2 . Совместное присутствие H 2 O 2 с ионом галогенида, таким как хлорид и пероксидаза, вызывает еще большее подавление бактерий и вирусов.Хлорид транссудата и пероксидазы сыворотки присутствуют во влагалище, 22 , и продукция H 2 O 2 с помощью Lactobacillus обеспечивает третий компонент относительно мощной системы, которая может убивать микроорганизмы. В концентрациях, которые присутствуют во влагалище, три комбинированных компонента этой системы подавляют бактерии и вирусы, включая ВИЧ in vitro . 9

Напротив, женщины с БВ обычно не имеют H 2 O 2 -продуцирующих Lactobacillus и не обладают ингибирующим действием на другую флору.Флора в BV сложна и, возможно, действует согласованно. Например, прививка G . vaginalis или Mobiluncus sp. Само по себе во влагалище не вызывало признаков вагинита на модели гривеновой обезьяны, но одновременное введение обеих этих бактерий во влагалище приводило к выделению из влагалища. 109 Лечение БВ метронидазолом, препаратом, не подавляющим M . hominis , снижает распространенность M . hominis вернулся к уровням, наблюдаемым у женщин без BV. 110

Характерный запах, присутствующий в BV, по-видимому, связан с производством аминов в результате метаболизма бактерий, присутствующих в BV. Нанесение КОН на выделения из влагалища приводит к улетучиванию аминов, которые связываются с белками при щелочном pH. Женщины часто жалуются на усиление запаха во время полового акта, когда семенная жидкость вызывает аналогичное временное ощелачивание влагалищной жидкости. Обнаруженные амины включают триметиламин, который, вероятно, производит большую часть характерного запаха, а также путресцин и кадаверин. 111

При использовании BV происходит значительное увеличение концентрации сукцината и других органических кислот. 33 Сукцинат подавляет хемотаксический ответ лейкоцитов. 107 Повышенные уровни эндотоксина, сиалидазы и муциназы могут еще больше усилить способность бактерий проникать через шейку матки в верхние отделы половых путей. 106 , 112 , 113


Женщины с БВ жалуются на запах из влагалища и усиление выделений из влагалища. 20 Зуд и раздражение вульвы не являются симптомами БВ. Симптомы и признаки особенно разнообразны при БВ, и диагноз может быть установлен только с помощью лабораторных исследований.

Клинические критерии для диагностики BV включают три из следующих: pH выше 4,5, однородный (обезжиренное молоко) внешний вид, запах амина с добавлением KOH и клетки-подсказки при микроскопии. 29 Нормальный pH 4,5 является хорошим отрицательным предиктором BV, потому что нормальный pH обнаруживается менее чем у 3% женщин с BV. 20 Ключ-клетки сами по себе обладают высокой предсказательной силой в отношении BV. 114 Диагностика BV окрашиванием по Граму с использованием небольшого количества морфотипов Lactobacillus (грамположительные палочки) и большого количества G. vaginalis и анаэробных морфотипов (маленькие грамотрицательные палочки) также позволяет прогнозировать BV. 24 BV может быть обнаружен в мазке PAP 115 и комбинацией pH и аминов (FemCard), но другие тесты на BV клинически бесполезны. Вагинальные посевы, в частности на г.vaginalis , особенно вводят в заблуждение, поскольку у 40% женщин без БВ во влагалище находится G. vaginalis . 116


Ожидается, что высокая концентрация потенциально вирулентных анаэробных бактерий вызовет другие инфекции. БВ был связан с различными инфекциями верхних отделов половых путей (таблица 4).

ТАБЛИЦА 4. Осложнения, связанные с бактериальным вагинозом

9685 9055–2,0

Послеродовой эндометрит



Приблизительный относительный риск

968 9685 905 0

Инфекция околоплодных вод






После кесарева сечения


После естественных родов


Воспалительное заболевание тазовых органов после аборта



BV был обнаружен у 12–22% из примерно 16 000 беременных женщин, участвовавших в исследованиях, в которых изучалась связь BV с преждевременными родами. 92 Когорты беременных пациенток происходили из разных социально-экономических слоев и стран. BV был более распространен, чем комбинированные числа для гонорейных, хламидийных инфекций и инфекций мочевыводящих путей в исследовании, которое изучалось для каждого из них, и в этой популяции относительный риск BV для преждевременных родов составлял 6%. 14 BV неизменно был связан с преждевременными родами и низкой массой тела при рождении в этих исследованиях. 92 BV присутствовал в 25–35% группе, родившей преждевременно, по сравнению с 10–18% среди тех, кто родил в срок, а относительный риск преждевременных родов для группы BV составлял от 1,5 до 2,3 по сравнению с таковыми. без БВ. 92

В крупнейшем из этих исследований, в котором участвовало более 11 000 пациентов, также изучались потенциальные искажающие переменные.После учета демографических факторов, курения, предшествующих преждевременных родов и восстановления других потенциальных патогенных микробов из влагалища и шейки матки, БВ оставался связанным с преждевременными родами (ОР = 1,6, 95% ДИ 1,2–2,0). 14 У женщин с BV, получавших антибиотики, эффективные против BV, частота преждевременных родов была такой же, как и у женщин без BV, что позволяет предположить, что лечение BV может снизить вероятность преждевременных родов.

BV может вызвать инфекцию околоплодных вод, если она причинно связана с преждевременными родами.БВ ассоциируется с повышенным риском инфицирования околоплодных вод, 117 хориоамнионической инфекции, 118 и гистологического хориоамнионита. 118 Бактерии, ассоциированные с БВ, составляют около половины изолятов околоплодных вод женщин, родившихся при преждевременных родах с неповрежденными плодными оболочками. 119 В срок клиническая инфекция околоплодных вод с лихорадкой во время родов встречалась в 1,5 раза чаще у пациентов с БВ, чем без нее. 120

В двух рандомизированных двойных слепых испытаниях лечения женщин с высоким риском преждевременных родов лечение БВ метронидазолом перорально привело к снижению частоты преждевременных родов. 121 , 122 Напротив, лечение женщин с низким риском преждевременных родов не привело к сокращению преждевременных родов, 123 , 124 и необходимы дополнительные исследования.


Относительный риск послеродового эндометрита (PPE) после кесарева сечения среди лиц с BV был в 5,8 раз выше, чем у лиц с доминирующей флорой Lactobacillus . 125 Этот высокий риск СИЗ возник после контроля продолжительности разрыва мембраны (которая была скорректирована с учетом продолжительности родов), что позволяет предположить, что БВ был связан с СИЗ независимо от наиболее важного акушерского фактора для такой инфекции.Около 60% бактерий, выделенных из эндометрия женщин с СИЗ, являются бактериями, ассоциированными с BV. 126 BV также ассоциируется с двукратным повышением риска СИЗ после родов через естественные родовые пути. 127


Целлюлит влагалищной манжеты возникает, когда вагинальные бактерии заражают операционное поле и инфицируют заполненное сывороткой пространство между вагинальной манжетой и брюшиной после гистерэктомии. Целлюлит влагалища после абдоминальной гистерэктомии встречается примерно в четыре раза чаще у пациентов с БВ, чем у пациентов с нормальной доминирующей флорой Lactobacillus . 11 , 128 Приписываемый риск БВ в развитии целлюлита манжеты составил 69% в одном исследовании. 11 Рандомизированное исследование лечения пациентов с БВ, перенесших гистерэктомию, не проводилось, но однократная доза 2 г тинидазола за 12 часов до операции значительно снизила послеоперационный целлюлит манжеты после вагинальной 129 и абдоминальной гистерэктомии. 130 В практических целях перед операцией женщины должны пройти обследование и лечение на БВ.


Спонтанное воспалительное заболевание тазовых органов (ВЗОМТ) часто вызывается гонореей или хламидийными инфекциями, а ВЗОМТ после искусственного аборта связано с Хламидиозом. 131 Однако ВЗОМТ после искусственного прерывания беременности также связано с БВ. Постабортный ВЗОМТ значительно чаще встречался у пациентов с БВ, чем без него (ОР = 2,3). 10 В последующем исследовании пациенты, перенесшие искусственный аборт с БВ, были приглашены для участия в рандомизированном двойном слепом исследовании плацебо или метронидазола.У пациентов, получавших плацебо, частота постабортных ВЗОМТ была в три раза выше, чем у пациентов, получавших метронидазол, 132 , что предполагает, что лечение следует проводить всем пациентам с БВ, перенесшим искусственный аборт.


Роль BV в спонтанном PID менее определена. Случайно выбранные пациенты клиники ЗППП с БВ имели более высокую вероятность, чем пациенты без БВ, иметь болезненность придатков даже после контроля гонорейных и хламидийных инфекций, что позволяет предположить, что БВ может быть связан с ВЗОМТ. 20 Среди женщин, отобранных с подозрением на ВЗОМТ, эндометрит плазматических клеток присутствовал у 65%. 133 В этом исследовании эндометрит был значительно связан с извлечением N. gonorrhoeae и C. trachomatis из эндометрия и с извлечением анаэробных грамотрицательных палочек из эндометрия (OR = 2,6). 133 Поскольку один только BV не был связан с эндометритом, он может не быть фактором риска развития эндометрита независимо от гонорейных и хламидийных инфекций, но наличие анаэробных грамотрицательных палочек в эндометрии может вызвать эндометрит плазматических клеток независимо от двух других Бактерии, передающиеся половым путем.Многие бактерии, извлеченные из трубок и особенно из абсцессов у женщин с ВЗОМТ, связаны с БВ. 134 Однако частота симптоматических ВЗОМТ среди женщин с БВ может быть низкой по сравнению с частотой приступов ВЗОМТ у женщин с гонорейными или хламидийными инфекциями.

BV может быть фактором эндометрита плазматических клеток. Среди женщин с выделениями из влагалища или тазовой болью в клинике ЗППП плазматический эндометрит присутствовал у 45% женщин с БВ по сравнению с 5% в контрольной группе без БВ. 135 В другом отчете плазматический эндометрит присутствовал у 40% женщин с одним только BV (без гонорейных или хламидийных инфекций) по сравнению с 13% женщин из контрольной группы без инфекции. 136 Эти объединенные данные не являются убедительными аргументами в пользу лечения БВ у бессимптомных небеременных женщин для предотвращения спонтанных ВЗОМТ.


In vitro , H 2 O 2 -продуцирующая Lactobacillus , особенно вместе с галогенид-ионом и пероксидазой, может убивать ВИЧ. 9 Женщины с БВ обычно не имеют H 2 O 2 -продуцирующих Lactobacillus 23 и, следовательно, могут подвергаться повышенному риску заражения ВИЧ в случае контакта. Два поперечных исследования выявили более высокий уровень БВ среди женщин с ВИЧ-инфекцией, чем у женщин с доминирующей флорой Lactobacillus . 91 , 137 В продольном исследовании женщин Малави, БВ, диагностированный во время беременности, был связан со значительным увеличением ранее сероконверсии ВИЧ (OR = 3.7) и после родов (OR = 3,5). 15 BV слабо связано с уровнем сероконверсии ВИЧ среди секс-работников в Кении. 138 Эти данные указывают на то, что у женщин с БВ может быть более высокий уровень развития ВИЧ-инфекции. Планируются испытания лечения BV, чтобы определить, влияет ли лечение BV на скорость заражения ВИЧ. За этими исследованиями следует внимательно следить, поскольку они могут привести к лечению бессимптомных небеременных женщин с БВ.



Несколько схем лечения противомикробными препаратами обеспечивают эффективность от 85% до 95%. Эти схемы включают прием метронидазола (500 мг) перорально два раза в день в течение 7 дней, 98 , 139 2% крем клиндамицина ежемесячно в течение 7 дней, 140 и 0,75% гель метронидазола, вводимый два раза в день в течение 5 дней 141 (таблица 5). Местные режимы связаны с меньшим количеством побочных эффектов, поскольку доза антибиотика низкая по сравнению с пероральной терапией.

ТАБЛИЦА 5. Лечение бактериального вагиноза




, 2 раза в день,


2% крем клиндамицин в.ч. в течение 7 дней

0.75% Метронидазол, гель 2 раза в день в течение 5 дней


Метронидазол, 2 г однократно

Клиндамицин, 7 300 мг 9506 9506

2 раза в день, 2 раза в день


Две схемы, которые обеспечивают уровень излечения от 80% до 85%, включают метронидазол (2 г), принимаемый перорально за один раз, 98 , 139 300 мг клиндамицина, принимаемый перорально в течение 7 дней, 142 и амоксициллин / клавулановая кислота (500 мг) три раза в день в течение 7 дней. 143

Схемы третьего ряда имеют минимальную эффективность при лечении БВ. Ампициллин или амоксициллин (500 мг), принимаемые перорально три-четыре раза в день, излечивают БВ только у 30-45% пациентов. 143 , 144 Ципрофлоксацин (500 мг), принимаемый перорально три раза в день 145 и тройной сульфатный вагинальный крем 116 , используемый два раза в день в течение 7 дней, обеспечивают эффективность от 20% до 50%. Как правило, эти схемы не следует использовать.

Некоторые препараты оказались неэффективными при лечении БВ.Эти агенты включают эритромицин, 147 тетрациклин, доксициклин 94 и несколько интравагинальных препаратов, включая повидон-йод, 148 гель уксусной кислоты и Lactobacillus. 149


BV часто подозревали в том, что он передается половым путем, хотя прямых доказательств не существует. Поскольку рецидивирующая инфекция является обычным явлением, некоторые исследователи рекомендуют лечение партнеров-мужчин. Существует четыре рандомизированных исследования, в которых терапия метронидазолом мужчин-половых партнеров женщин с БВ не влияла на последующие рецидивы БВ у женщин. 98 , 99 , 100 Лечение партнера-мужчины не следует проводить при обычном лечении БВ.


Показатели излечения высоки при использовании препаратов первого или второго выбора, но небольшая группа женщин страдает быстрой или повторяющейся рецидивирующей инфекцией. Причина рецидива инфекции не выяснена, но одна из возможных причин — резистентные бактерии. Пациентов с быстро рецидивирующей инфекцией следует эмпирически перевести на альтернативный противомикробный препарат, например, с метронидазола на клиндамицин.Пациентам, у которых заболевание рецидивирует после смены противомикробных препаратов, я даю интравагинальный препарат метронидазола или клиндамицина в течение 3 недель с последующей интравагинальной терапией каждые 3 дня в течение дополнительных 3 недель. Последняя часть схемы предназначена для подавления бактерий, вызывающих BV, в то же время позволяя Lactobacillus повторно колонизироваться во влагалище. Некоторым пациентам, у которых развиваются рецидивы, связанные с половым актом, полезно принимать таблетку метронидазола при каждом эпизоде ​​полового акта.


Атрофический вагинит — это симптоматическое воспалительное состояние влагалища, вызванное дефицитом эстрогена вагинальным эпителием. Симптомы включают вагинальное кровотечение и болезненность, внешнюю дизурию, зуд и диспареунию. Диагноз атрофического вагинита можно подтвердить, обнаружив в мазке из влагалища гладкую бледно-розовую поверхность влагалища без морщин и преобладание парабазальных клеток. Может существовать умеренное раздражение вульвы. Выделения обычно небольшие, с pH выше 5.Микроскопия обычно выявляет отсутствие микроорганизмов, включая лактобациллы, хотя бактериология атрофического вагинита еще не определена. Следует исключить новообразования, инородные тела и другие инфекционные причины симптомов. Атрофический вагинит лечится эстрогенами местного действия, которые утолщают вагинальный эпителий и уменьшают симптомы. Крем с эстрогеном можно вводить во влагалище один раз в день в течение 2 недель, а затем через день в течение 2 недель. У большинства пациентов терапию эстрогенами можно полностью прекратить без повторения симптомов.Поскольку вагинальные эстрогены легко всасываются, длительное вагинальное применение эстрогенов имеет те же недостатки, что и системное применение у женщин в постменопаузе, и для большинства пациентов терапия обычно не требуется после 4 недель.


Примерно 5% женщин с вагинитом имеют одно из множества гетерогенных вагинальных состояний. Многие женщины имеют DIV, характеризующуюся симптомами обильного раздражения, выделений из влагалища, раздражения вульвы и часто боли во время полового акта. 17 Физические признаки включают гнойные выделения из влагалища с pH выше 5 и пятна эритемы слизистой оболочки во входе и в верхней трети влагалища. 17 Большое количество лейкоцитов, парабазальных клеток, мелких бактерий и никаких лактобацилл или ключевых клеток не обнаруживается во влажном растворе солевого раствора. Причина DIV неизвестна. Пациенты, как правило, имеют высокие концентрации стрептококков или колиформ группы B, выделенных из влагалища, но эти бактерии не могут быть основной причиной инфекции.У женщин с DIV симптомы могут проявиться при лечении антибиотиками. Обычно у них нормальный иммунитет, хотя у некоторых есть аутоиммунные заболевания. Я обнаружил, что пациенты ответили на прием 2% клиндамицина 17 или 2% крема цефалексина каждую ночь в течение 4 недель с последующим лечением через ночь в течение еще 4 недель. В качестве альтернативы, суппозитории с гидрокортизоном (Anusol HC) можно чередовать с кремом с антибиотиком интравагинально в течение 4 недель у пациентов с подавленным иммунитетом или аутоиммунным заболеванием.Частота рецидивов умеренно высока при всех режимах.

Микробиота мочи мужчин и женщин и ее изменения у женщин при бактериальном вагинозе и лечении антибиотиками | Микробиом

Характеристики субъектов

Средний возраст здоровых мужчин составлял 29 лет и находился в диапазоне от 23 до 58 лет. Средний возраст здоровых женщин также составлял 29 лет и колебался от 19 до 62 лет. Средний возраст женщин с БВ составлял 31 год, а их возраст колебался от 18 до 51 года (таблица 1).Ни у одного из здоровых участников не было выявлено BV или пародонтита, и 12% принимали антибиотики в течение 10 дней до внесения образца, что не оказало заметного влияния на микробные сообщества этих участников исследования (дополнительный файл 1: Рисунок S1). В группе исследования БВ 23,3% ранее страдали БВ и 2,3% страдали пародонтитом. Восемьдесят четыре процента пациентов были выходцами из европеоидной расы и 12% — африканцами. Ни один из пациентов с BV не принимал антибиотики за 10 дней до инцидента с BV.

Таблица 1 Обзор различных исследовательских групп

Таксономическая принадлежность прочтений

После фильтрации по численности было получено 497 OTU и всего 4 389 556 прочтений рибосомной ДНК V1-V2 (среднее значение на образец = 16 502 ± стандартное отклонение = 10 396 прочтений). Тридцать восемь процентов последовательностей можно отнести к уровню вида, 42% к уровню родов и 20% к уровню семейства или более высоким таксонам. Полная таблица OTU доступна в Дополнительном файле 2: Таблица S1.Был проведен анализ разрежения, который показал, что большинство образцов имели или почти достигли насыщения (дополнительный файл 3: рисунок S2). Шесть образцов из группы исследования BV были исключены из-за слишком малого количества считываний секвенирования (среднее значение на образец = 694 ± SD = 605 считываний). Поскольку глубина секвенирования тогда составляла от 2196 до 69 765 считываний, набор данных был повторно дискретизирован для определения ошибки, вносимой повторной дискретизацией. Четыре образца с разной глубиной секвенирования (5042 чтения; 17 477 операций чтения; 43 494 чтения и 69 765 операций чтения) были повторно дискретизированы 20 раз (дополнительный файл 4: рисунок S3).Стандартная ошибка была очень низкой для OTU с высоким содержанием и до 5% для OTU с низким содержанием. Поскольку это исследование не фокусируется на редких OTU, повторной выборки этого набора данных было достаточно.

Микробиота мужской мочевыделительной системы сгруппирована как часть женской мочевой микробиоты, которая различалась по здоровью и BV

Здоровая мужская микробиота мочевой системы (MUM) сгруппирована в двух различных частях женской здоровой мочевой микробиоты (FUM) (рис. 1a, красные кружки). Таким образом, было невозможно различить MUM и FUM на основе состава микробиоты.ФУМ дополнительно характеризовался бактериальными сообществами, которые не могли быть обнаружены в МУМ. Сравнение микробиоты мочи здоровых женщин с микробиотой мочи женщин с острым BV показало разделение на два разных кластера и перекрывающуюся область, где находилась подгруппа образцов от здоровых женщин, а также женщин с симптомами (рис. 1b, красные кружки). Интересно, что образцы, взятые после лечения метронидазолом, в основном оставались в кластере BV, и никакого сдвига в сторону кластера «здоровье» не наблюдалось (рис.1б). Пероральное лечение метронидазолом, по-видимому, не повлияло на бактериальное сообщество мочи. В то время как микробиота влагалища была сильно изменена антибиотиком [23], FUM не мог быть перемещен в здоровый кластер с помощью лечения метронидазолом (дополнительный файл 5: Рисунок S4).

Рис. 1

Принципиальная координация анализа микробиоты мочи здоровых мужчин и женщин ( a ) и женщин во время острого BV, после лечения метронидазолом и в состоянии здоровья ( b )

Лечение БВ метронидазолом приводит к потере разнообразия микробиоты женской мочи

Разнообразие микробиоты мочи явно различалось в различных группах лечения, проанализированных здесь: разнообразие было наибольшим у здоровых мужчин, за ними следовали здоровые женщины, затем женщины с острым BV и был самым низким у женщин после лечения БВ метронидазолом (рис.2). Интересно, что микробиота мочи здоровых мужчин, хотя и вложена в кластер здоровой женской микробиоты, имела более высокое разнообразие Шеннона, но более низкое альфа-разнообразие, чем у женщин, что указывает на то, что присутствовало меньше ОТЕ, но их численность была более равномерно распределена. В выборках здоровых мужчин было обнаружено 308 OTU, и требовалось 16 OTU для покрытия 50% совокупной численности, в то время как было идентифицировано 365 OTU и 9 OTU, необходимых для покрытия 50% совокупной численности в выборках здоровых женщин.Разница в альфа-разнообразии и ранговом содержании в моче женщины с BV или без нее была минимальной, последняя содержала 368 различных OTU, а для 50% -ного содержания требовалось 8 OTUS. Разнообразие исчезло после лечения метронидазолом, так как было идентифицировано только 275 OTU, а для покрытия половины общей численности потребовалось 6 OTU. Об этом также свидетельствует индекс Шеннона (H ‘), который был самым высоким у здоровых мужчин (H’ = 2,45 ± 0,94) и женщин (H ‘= 2,27 ± 0,91; рис. 2b). Разнообразие микробиоты мочи уменьшилось у женщин с острым БВ (H ‘= 1.89 ± 0,64), в отличие от ситуации с вагинальной жидкостью, где БВ ассоциируется со значительным увеличением разнообразия, а здоровье влагалища связано с низким разнообразием. Этот сдвиг в разнообразии был значительным ( p = 0,014). Лечение метронидазолом привело к дальнейшему значительному уменьшению разнообразия в моче (H ‘= 1,66 ± 0,69, p = 0,042). Таким образом, микробные сообщества женщин в моче были значительно менее разнообразны после лечения метронидазолом, чем у здоровых женщин ( p = 0.0008). Эти находки можно интерпретировать как результат увеличения относительной численности BV-ассоциированных OTU во время BV, что, таким образом, снижает разнообразие. После лечения метронидазолом рост устойчивых к метронидазолу OTU мог еще больше снизить микробное разнообразие, когда BV-ассоциированные OTU уже были искоренены (дополнительный файл 6: Рисунок S5).

Рис. 2

Ранговая численность и разнообразие Шеннона мочевой микробиоты. a График преобладания кумулятивных проб от здоровых мужчин и женщин и женщин во время острого BV и после лечения метронидазолом. b Индексы Шеннона всех групп. Показаны среднее значение и квартильный диапазон. Звездочки указывают на значимые ( p <0,01) различия

Восемь различных уротипов были идентифицированы в микробиоте мочи.

Микробиота мочи здоровых мужчин и женщин, а также женщин с БВ сгруппирована в восемь различных уротипов (Таблица 2) (Рис. 3). Уротип (UT) 1 состоял из четырех подкластеров (от a до d), а UT 3 — из двух подкластеров (a и b).Все кластеры содержали образцы от мужчин и женщин при остром БВ и после лечения метронидазолом, за исключением UT 2, который был обнаружен только у женщин (как во время BV, так и после лечения метронидазолом), и UT 7, который был обнаружен только у здоровых женщин. .

Таблица 2 Обзор всех уротипов и их характеристики Рис. 3

Индивидуальная микробиота мочи здоровых мужчин, женщин и женщин во время острого БВ сгруппирована в соответствии с уротипами.Кластеризация выборок была проведена на основе Евклидова расстояния с использованием метода кластеризации Уорда в R. Показаны 19 наиболее распространенных OTU, а все остальные (относительная распространенность <1,2% каждая) суммированы как «другие». Уротипы (UT) 1–8 с подтипами указаны в прямоугольниках над графиком относительной численности. Цветные прямоугольники над графиком численности указывают источник выборки, а серые прямоугольники декодируют разнообразие (H ‘)

UT 1 характеризовался большим разнообразием (H ′ UT1 = 2.44 ± 0,61) и высокой относительной численностью BV-ассоциированных ОТЕ Prevotella amnii , Sneathia amnii , Gardnerella vaginalis и Atopobium vaginae , которые определили четыре субкластера. UT 1a характеризовалась высокой относительной численностью P. amnii и более низкой относительной численностью S. amnii , G. vaginalis , A. vaginae , Sneathia sanguinegens , L. iners и Lactobacillus. crispatus .Он показал два отдельных подкластера, один из которых содержал только образцы здоровых мужчин и женщин, а другой — только образцы женщин с BV. Эти два подкластера показали заметную разницу в разнообразии, например относительно высокое разнообразие у здоровых мужчин и женщин по сравнению с меньшим разнообразием у женщин с БВ (H ‘ UT1a-HEALTH = 3,27 ± 0,12 против H’ UT1a- BV = 2,13 ± 0,46, p = 0,0015) . UT 1b характеризовался высокой относительной численностью S. amnii , а также численностью L.iners , A. vaginae , G. vaginalis и S. sanguinegens и малочисленные L. crispatus и P. amnii . UT 1c определялась высокой относительной численностью G. vaginalis и далее характеризовалась обилием A. vaginae и L. crispatus и более низкой относительной численностью Prevotella sp. и Sneathia sp . UT 1d определялся высокой относительной численностью A. vaginae по сравнению с другими кластерами в пределах UT 1 и, как и UT 1b, характеризовался более высокой относительной численностью L.Инерс . В относительном количестве UT 1b, c и d преобладали образцы от женщин с BV, но также присутствовало несколько образцов от здоровых мужчин и женщин. UT 2 в основном состоял из L. iners и имел умеренное разнообразие (H ‘ UT2 = 1,79 ± 0,63). Он был доминирующим OTU в этом UT и в некоторых образцах, сопровождаемых BV-ассоциированными бактериями, такими как S. amnii и S. sanguinegens . UT 2 был обнаружен только у женщин, как с, так и без BV. UT 3 характеризовался Enterobacteriaceae и умеренным разнообразием (H ‘ UT3 = 1.63 ± 0,63). Этот уротип можно подразделить на уротипы 3a и 3b в соответствии с относительной численностью Sh. sonnei (UT 3a) и Escherichia coli (UT 3b), соответственно, и встречались как при здоровье, так и при болезни как у мужчин, так и у женщин. UTs 3a и 3b далее характеризовались обильными Propionibacterium propionicus или Enterococcus faecalis . В относительной численности UT 4 сильно доминировал Enterococcus faecalis и, следовательно, он имел низкое разнообразие (H ‘ UT4 = 1.18 ± 0,67), UT 5 в основном состоял из Streptococcus agalactiae и имел умеренное разнообразие (H ‘ UT5 = 1,45 ± 0,88), а в UT 6 сильно доминировали Citrobacter murliniae и, следовательно, также было очень низкое разнообразие. (H ′ UT6 = 0,85 ± 0,43). Все эти уротипы были смешанными, т.е. они содержали образцы здоровых мужчин и женщин и женщин с БВ. В относительной численности UT 7 преобладали L. crispatus , имевшие высокое разнообразие (H ‘ UT7 = 2.05 ± 0,74) и был обнаружен только в образцах здоровых женщин. UT 8 представлял собой весьма разнообразный (H ‘ UT8 = 2,29 ± 0,81) смешанный кластер, содержащий образцы от здоровых мужчин и женщин, а также женщин с BV, и характеризовался рядом подкластеров, содержащих L. crispatus и L. iners , Lactobacillus gasseri , Chitinophagaceae или Veillonellaceae.

Таким образом, между здоровыми мужчинами и женщинами и женщинами с БВ не наблюдалось устойчивой разницы в уротипах, за исключением UT 7, который состоял из образцов только от здоровых женщин, как наблюдалось ранее.Выборки здоровых людей, как мужчин, так и женщин, сгруппированы в основном в UT 1a (75%), UT 4 (62%) и UT7 (100%).

Индивидуальные микробные профили мочи сильно реагировали на лечение метронидазолом

Сильные сдвиги в составе микробиоты наблюдались почти у каждой женщины после лечения метронидазолом (рис. 3a) (дополнительный файл 4: рисунок S4), и совокупные данные показывают, что все были затронуты многочисленные таксоны (рис. 3б). Однако, несмотря на эти сдвиги в индивидуальных микробных профилях, женщин с острым BV нельзя было отделить от тех, кто прошел лечение метронидазолом в PCO (рис.1б). Кластеризация состава микробиоты показала, что определенные уротипы сохранялись после лечения метронидазолом, такие как UTs 1, 2 и 3, и был идентифицирован дополнительный уротип (рис. 3c). Этот UT 9 определялся высокой относительной численностью OTU Chitinophagaceae и дополнительно характеризовался присутствием L. iners и L crispatus . Он был вложен в UT 8 (до лечения метронидазолом). Глубина секвенирования и концентрация ДНК после экстракции тех образцов с высокой численностью Chitinophagaceae были проанализированы из-за риска того, что они могут быть контаминантом [29].Число считываний было ниже среднего, но не внизу (медиана 8757 считываний по сравнению с 17 187 считываний после фильтра изобилия) и выше среднего для выхода ДНК (медиана 9,2 нг / мкл по сравнению с 5,9 нг / мкл).

Мы сравнили те уротипы, которые присутствовали до и после лечения метронидазолом, для обогащения определенных ОТЕ с использованием LEfSe (рис. 3d). В UT 1 не было обнаружено значительных различий в отношении P. amnii , S. amnii , G. vaginalis и A.vaginae , те OTU, которые характерны для UT 1. Однако лечение метронидазолом привело к увеличению других BV-ассоциированных OTU, таких как BVAB2, BVAB3 и Megasphaera. В UT 2 уротип, который в основном состоит из L. iners , этот вид увеличился после лечения антибиотиками, в то время как G. vaginalis уменьшился. В UT 3, охарактеризованном Enterobacteriaceae , наблюдалось увеличение другого Enterobacteriaceae OTU, классифицированного как Shigella dysenteriae .Здесь также относительная численность G. vaginalis была уменьшена путем лечения антибиотиками. Таким образом, лечение метронидазолом привело к снижению на G. vaginalis в UT 2 и UT 3, но не к UT 1, и сопутствующему увеличению количества других бактерий, особенно L. iners , BVAB2, BVAB3, Megasphaera и других бактерий. Enterobacteriaceae OTU отнесен к Shigella dysenteriae .

Взаимосвязь между микробиотой вагинальной жидкости и мочи в BV

Поскольку можно ожидать, что анализируемые здесь пробы мочи в середине потока в определенной степени содержат микробиоту влагалищной жидкости, мы сравнили пробы мочи до и после лечения метронидазолом с образцами вагинальной жидкости одни и те же пациенты и в одно и то же время.На рисунке 4а показано, что подмножество примерно 40% образцов сгруппировано вместе, несмотря на различия в статусе BV (острый BV или после лечения метронидазолом) и источнике образца (вагинальная жидкость или моча). Остальные образцы были сгруппированы по источнику (моча или вагинальная жидкость), но не по статусу BV (острый BV или после лечения метронидазолом).

Рис. 4

Микробиота мочи во время острого БВ и после лечения метронидазолом. a Principle координирует анализ образцов мочи женщин с БВ до ( красный, ) и после ( зеленый, ) лечения метронидазолом.Образцы от тех же женщин соединены черной линией . b Среднее относительное содержание микробиоты мочи во время острого БВ и после лечения метронидазолом. Показаны 19 самых распространенных OTU, а остальные OTU суммированы как «другие». c Кластеризация микробов мочи после лечения метронидазолом. Кластеризация выборок проводилась на основе евклидова расстояния с использованием метода кластеризации Уорда в R. Urotypes указаны. d LefSe анализ микробиоты мочи, относящейся к UT1, UT2 и UT3, до и после лечения метронидазолом

Чтобы понять эти кластеры, мы проанализировали корреляцию микробного профиля мочи с микробным профилем вагинальной жидкости у одной и той же пациентки и разделили образцы в соответствии с UT и рассмотрели только те, которые были значительно коррелированы ( p после коррекции Бонферрони ≤0.01, Таблица 3) (Дополнительный файл 5: Рисунок S5). Все значимые корреляции имели коэффициент корреляции r ≥ 0,6. В UT 1 большинство образцов мочи и вагинальной жидкости достоверно коррелировали друг с другом (59%). При всех других уротипах ни один образец вагинальной жидкости или только несколько образцов вагинальной жидкости не коррелировали с соответствующим образцом мочи. После лечения у двух из шести пациенток в UT 1 и у одной в UT 2 была обнаружена корреляция между влагалищной жидкостью и микробиотой мочи, но ни один из образцов мочи от других уротипов не коррелировал с составом микробиоты влагалищной жидкости.Эти данные показывают, что вагинальная жидкость и моча наиболее похожи, когда в сообществах преобладают в относительной численности бактерии, такие как P. amnii , S. amni , G. vaginalis или A. vaginae . Однако большая часть микробиоты мочи не коррелировала с их аналогом из влагалищной жидкости, что позволяет предположить, что микробиота находится в мочевом пузыре и уретре, а не во влагалище.

Таблица 3 Корреляция микробиоты влагалища и мочи у одних и тех же женщин

Затем мы проанализировали среднее относительное количество ОТЕ в образцах мочи и вагинальной жидкости при БВ до и после лечения метронидазолом и сравнили его со здоровым ФУМ.На рисунке 4b показано, что BV-ассоциированные бактерии, характерные для UT 1 ( P. amnii , S. amni , G. vaginalis и A. vaginae ), присутствовали в большом количестве как в моче, так и в вагинальной жидкости при BV. Этот результат согласуется с высокой корреляцией между микробиотой мочи и влагалищной жидкости при БВ до лечения антибиотиками у тех пациентов, у которых микробиота мочи относится к UT 1 (Таблица 3). Кроме того, две OTU, принадлежащие к Veillonellaceae , также были в большом количестве как в моче, так и во влагалищной жидкости при БВ.Все эти OTU были сильно уменьшены обработкой метронидазолом в обоих типах образцов. OTU, которых было много в образцах вагинальной жидкости, но не в моче, были S. sanguinegens и несколько OTU, принадлежащих к роду Prevotella .

Интересно, что одним из наиболее поразительных результатов лечения метронидазолом было увеличение среднего относительного содержания л. Iners как во влагалищной жидкости, так и в моче до уровней, превышающих уровни, обнаруживаемые в здоровой моче.Напротив, L. crispatus , который является наиболее распространенным видом Lactobacillus во влагалищной жидкости здоровых женщин, а также присутствует в здоровой FUM, где он составляет UT 7 (рис. 5), почти отсутствовал в моче после приема метронидазола. лечение; хотя он присутствовал в высоком среднем относительном количестве во влагалищной жидкости у тех же пациенток.

Рис. 5

Сравнение микробиоты мочи и вагинальной жидкости при остром БВ и после лечения метронидазолом. a Анализ главных координат. b Тепловая карта средней относительной численности 20 наиболее распространенных таксонов. Met метронидазол

ОТЕ, которые были в большом количестве в моче, но не во влагалищной жидкости: Chitiniphagaceae , E. faecalis , E. coli , S. sonnei , S. agalactiae , Citrobacter murliniae и Propionibacterium. Пропионикус . За исключением Chitinophagaceae , они были обнаружены как в BV, так и в здоровье.Лечение метронидазолом мало повлияло на их среднее относительное содержание. Таким образом, за заметным исключением бактерий, ассоциированных с BV, большинство OTU показали дополнительную картину средней относительной численности, то есть они были либо в большом количестве в моче, либо в образцах вагинальной жидкости. Лечение метронидазолом не повлияло на те ОТЕ, которых было много только в моче.

Кожная флора — обзор

Бактериальное заболевание

Приматы, не являющиеся людьми, имеют постоянную кожную флору. Staphylococcus и Streptococcus часто обнаруживаются на коже во время нормальных состояний и, по-видимому, важны для поддержания pH кожи и подавления акклиматизации нерезидентных патогенов.Резидентные бактерии генетически мономорфны для хозяина (Zimmerman, 1977), а резидентные организмы эволюционируют, чтобы адаптироваться к хозяину (Kloos et al., 1979, 1983).

Повышенное количество нерезидентных патогенов типично для кожных заболеваний. Иммунодефицит может позволить нормальной флоре вызывать клинические поражения. Такие инфекции плохо поддаются традиционной терапии.

Состояние, похожее на импетиго, характеризующееся влажной пиодермией на животе и темным изменением цвета прилегающей кожи, обычно наблюдается у выращиваемых в питомниках макак, у которых субстрат инкубатора влажный, что сохраняет кожу влажной.Стрептококковые организмы обычно изолированы, и состояние легко поддается лечению антибиотиками и улучшенными санитарными условиями.

Широкий спектр бактериальных агентов может быть связан с кожными и подкожными инфекциями (рис. 11.7). Кишечные возбудители часто выделяются из травм. Pseudomonas aeruginosa и Proteus mirabilis часто изолированы и трудно поддаются лечению; ассоциированный целлюлит является обширным и некротическим (Line et al., 1984).Неожиданные организмы, такие как Haemophilus infiuenzae , были выделены из подкожных абсцессов (Burr et al., 1982). Сообщалось о Corynebacterium ulcerans (май 1972 г .; Bergin et al., 2000). Clostridium sp. также могут быть изолированы от травм (Boncyk and Kalter, 1980). Проникающие раны кожи с последующим инфицированием Clostridium tetani могут привести к паралитическому заболеванию (Kessler et al., 1979). Это особенно потенциальная проблема у нечеловеческих приматов, содержащихся на открытом воздухе, и вакцинация может быть профилактической.Инъекции через загрязненную кожу могут привести к глубокому заражению бактериями и, возможно, Clostridium perfringens связанной с газовой гангреной (Meier et al., 2007). Burkholderia pseudomallei вызывает мелиоидоз и является эндемиком Юго-Восточной Азии. Сообщалось о случаях заболевания макак, недавно завезенных из этого региона, и шимпанзе, контактировавших с этими животными. Типичное проявление — длительный или рецидивирующий свищ с гнойным отделяемым, но животные часто имеют сопутствующее системное заболевание.Дренажные пути могут быть связаны с основной инфекцией костной структуры, связанной с хирургическими имплантатами, или из-за подкожных абсцессов. Организм обладает высокой устойчивостью к большинству антибиотиков. Больных животных следует удалить из колонии и принять меры для предотвращения передачи зоонозов, поскольку это заболевание потенциально смертельно для людей (Kaufmann et al., 1970; Douglas et al., 1971; Dance et al., 1992). Сообщалось о наличии актиномицетов в результате гранулематозного абсцесса. Диагностическое подтверждение подтверждается наличием гранул серы в экссудатах (Weidman, 1935).

РИСУНОК 11.7. Срез волосатой кожи взрослой макаки-резус с тяжелым очаговым обширным гнойным дерматитом, характерным для бактериального дерматита.

Возбудителя в данном случае не выявлено.

Экспериментально имплантированные устройства, такие как черепные имплантаты и постоянные внутривенные катетеры с кожными выходами, могут служить очагом бактериальных инфекций. Staphylococcus spp. , Enterococcus spp., Streptococcus spp.и Corynebacterium ulcerans были связаны с инфекциями имплантатов головы (Lee et al., 1998; Bergin et al., 2000). Staphylococcus является наиболее распространенным изолятом из катетерных путей, и сообщается о высокой частоте метициллин-резистентной инфекции Staphylococcus , связанной с инфекциями катетерного тракта (Taylor et al., 1998).

Бактерии, устойчивые к антибиотикам, в частности, метициллинрезистентные Staphylococcus aureus (MRSA), вызывают серьезную озабоченность в медицине человека.Информация об инфекции MRSA в колониях нечеловеческих приматов ограничена. Как упоминалось ранее, катетерные пути могут служить очагом инфекции MRSA. Имеется единичный отчет о метициллин-резистентном Staphylococcus , отличном от aureus , у макаки-резус, подвергшейся облучению всего тела (Kolappaswamy et al., 2008). Однако было бы неудивительно, если бы в ближайшем будущем были зарегистрированы дополнительные случаи, учитывая рост числа устойчивых к антибиотикам бактериальных инфекций у людей.

Нома — это быстро развивающийся некротический гингивит и стоматит, который часто прогрессирует, поражая как подлежащую кость, так и вышележащую кожу. Вовлеченные ткани становятся красными, отечными, ишемическими, некротическими и шелушатся в течение трех-четырех дней. Поражения обычно ограничиваются одной частью зубного ряда. Точная этиология этого заболевания остается неустановленной, но из поражений выделяют множество микроорганизмов. Наиболее частые изоляты у человека включают Fusobacterium necrophorum , Prevotella intermedia , Streptococcus spp.и спирохетальные организмы (Falkler et al., 1999; Enwonwu et al., 2006). Поражения мягких тканей могут реагировать на поддерживающую терапию и обработку раны с помощью агрессивной местной и системной антимикробной терапии (Kimura, 2008), но возникающий кожный дефект может сохраняться на всю жизнь. При некрозе костей и сопутствующем остеомиелите ответ на терапию плохой, а смертность высока. Заболевание макак часто связано с иммуносупрессией, вторичной по отношению к обезьяньему ретровирусу типа D (Schiodt et al., 1988), хотя серьезное недоедание также следует рассматривать как возможную причину. Нома также отмечена у тамарина с хлопковым верхом ( Saguinus oedipus ) (Brack, 1982). В этом случае состояние не было связано с выявленной ретровирусной инфекцией.

Спонтанная инфекция Mycobacterium leprae была зарегистрирована у покрытых сажей мангабея (Meyers et al., 1985), обыкновенного шимпанзе (Leininger et al., 1978, 1980; Baskin, 1993) и макак cynomolgus (Gormus et al. ., 1998). Первоначальный случай проказы в мангабее был передан от человека, и возможность передачи зооноза существует, но не подтверждена (Hagstad, 1983a, 1983b). Туберкулоидная проказа характеризуется образованием кожных гранулем, которые часто изъязвляются. При лепроматозной лепре происходит более слабый иммунный ответ хозяина, что приводит к более многочисленным поражениям. Кожные поражения проказы чаще всего наблюдаются на участках тела с немного более низкой температурой кожи, таких как уши, руки, ступни, хвост и надбровные дуги.Может оказаться полезным внутрикожное тестирование лепромина; серологические тесты на антитела более последовательны в постановке диагноза. Кислотно-быстрое окрашивание мазков-слепков с изъязвленных участков не всегда выявляет микроорганизмы. Была разработана модель лепры на макаках-резусах (Gormus et al., 1998).

Mycobacterium sp. были изолированы от подкожных свищей, трактов и абсцессов (Rush, 1977; Hines et al., 1995), а также при генерализованных инфекциях (Chandrasekharan et al., 1951; Lindsey et al., 1966). Регионарные лимфатические узлы могут образовывать свищи и выступать в качестве очага рецидива. Поражение плохо поддается лечению (Wolf et al., 1988). Обычно этиологическим агентом является атипичная микобактерия . Mycobacterium kansasii была зарегистрирована в колонии резусов (Valerio et al., 1978). Сопутствующая инфекция иммунодепрессивным ретровирусом может предрасполагать нечеловеческих приматов к микобактериальной инфекции.

Распространенность бактериального вагиноза и его связь с факторами риска среди небеременных женщин: исследование на базе больниц

Бактериальный вагиноз (БВ) — это экологический дисбаланс микробиоты влагалища, поражающий в основном женщин репродуктивного возраста.Это исследование проводилось среди 160 небеременных женщин, зарегистрированных в амбулаторном отделении гинекологии / акушерства больницы медицинского колледжа KIST, Имадол, Лалитпур, Непал, с ноября 2014 года по май 2015 года. факторы риска БВ и проанализировать тип бактерий, связанных с БВ. В этом исследовании для диагностики BV использовался метод оценки Nugent. Общая распространенность БВ среди пациентов с симптомами заболевания составила 24,4%. Спринцевание было статистически связано с БВ.Кроме того, BV в значительной степени ассоциировался с консистенцией, запахом и количеством аномальных выделений из влагалища. Было обнаружено, что пользователи противозачаточных средств на анатомических участках более подвержены БВ, чем те, кто не использовал противозачаточные средства на анатомических участках. Pseudomonas spp., Escherichia coli, Acinetobacter spp. , Proteus spp. , Klebsiella spp. , Neisseria gonorrhoeae, Enterobacter spp. , Citrobacter spp. , Staphylococcus aureus, Коагулазонегативные стафилококки (CoNS) , и Streptococcus agalactiae были связаны с BV и из этих Lactobacillus spp.был преобладающим организмом. Более высокая распространенность БВ среди пациентов с симптомами указывает на необходимость вмешательства для снижения частоты мертворождений, абортов и бесплодия.

1. Общие сведения

Вагинит — это воспаление влагалища, обычно характеризующееся одним из следующих признаков: выделения из влагалища, содержащие много лейкоцитов, зуд вульвы, раздражение вульвы, запах из влагалища, эритема влагалища, диспареуния и дизурия. [1, 2]. Тремя наиболее частыми причинами вульвовагинита являются бактериальный вагиноз (БВ), который является наиболее распространенным, за ним следуют кандидоз и трихомониаз [3].БВ — распространенная вагинальная инфекция, которая чаще встречается у женщин детородного возраста [4].

BV — это клиническое состояние, характеризующееся жидкими, серыми / не совсем белыми, однородными, с неприятным запахом прилипшими влагалищными выделениями, которые более заметны после полового акта и менструации, при pH> 4,5. Рыбный запах отмечается при добавлении 10% гидроксида калия к влагалищной жидкости (тест на запах), а также наличие ключевых клеток, небольшое количество лактобацилл или их отсутствие, а также небольшое количество (<1 / hpf) полиморфно-ядерных лейкоцитов (PMN). характерные черты БВ [5].

Во многих случаях БВ протекает бессимптомно или проявляется только зловонными выделениями из влагалища без жалоб на воспаление [6]; таким образом, BV называют «вагинозом», а не «вагинитом» [7].

Молочная кислота, продуцируемая нормальной флорой, Lactobacillus путем продуцирования перекиси водорода (H 2 O 2 ), относится к кислой среде влагалища. Это обеспечивает местный защитный механизм, подавляя рост других организмов.Изменение нормальной микрофлоры влагалища одновременно вызывает изменение рН, что позволяет разрастаться множеству анаэробов и факультативных бактерий и вызывать хронические инфекции, а также аномальные выделения из влагалища [5, 8]. Лактобациллы также продуцируют антимикробные вещества, такие как молочная кислота, H 2 O 2 и бактериоцин, чтобы способствовать здоровой экосистеме влагалища, тем самым подавляя рост патогенов [8, 9].

Помимо Lactobacillus spp., Другие бактерии также часто встречаются в микробиоте влагалища здоровых женщин.Обнаруженными микроорганизмами являются грамположительные кокки и грамотрицательные палочки, а именно Streptococcus spp., Staphylococcus spp. И представители Enterobacteriaceae, в основном E. coli в дополнение к другим анаэробным видам, например, Bacteroides spp., Bifidobacterium spp., Propionibacterium , Fusobacterium spp., Peptococcus spp., Prevotella spp., Veillonella spp., Peptostreptococcus spp., Atopobium vaginae , Gardnerella vaginalis , Ureaplasma urealiticum , Mycoplasma hominis, и Mobiluncus [10, 11]. Когда популяционный уровень лактобацилл снижается ниже критического уровня, эти условно-патогенные бактерии могут перерасти, становясь доминирующими видами в окружающей среде [12].

При беременности вагинальные инфекции могут быть связаны с тяжелыми осложнениями как для матери, так и для новорожденного [13], что приводит к гинекологическим и акушерским осложнениям [12].БВ также увеличивает риск заражения вирусом иммунодефицита человека (ВИЧ) и заболеваниями, передаваемыми половым путем (ЗППП). БВ можно рассматривать как заболевание, усиленное половым путем (СЭП), а не как ЗППП, в которых частота половых контактов играет ключевую роль [14]. Следовательно, необходимо уделять больше внимания изучению основных профилактических стратегий.

Профилактические стратегии нацелены на факторы риска или поведение для заболевания. Исследования показывают, что БВ связан с рядом факторов риска и поведения, включая возраст, семейное положение, статус занятости, род занятий, недавнее употребление антибиотиков, снижение выработки эстрогена в организме хозяина, спринцевание, половую активность, более низкий возраст первого полового акта, более частое эпизоды восприимчивого орального секса, использование спермицидов, ЗППП, работа секс-работником, курение, употребление алкоголя, стресс, используемые противозачаточные средства, частота вагинальных половых сношений и расовая / этническая принадлежность [15, 16].В ряде обсервационных исследований сообщается, что у женщин, использующих гормональные контрацептивы, снижен риск рецидива БВ [17].

В частности, среди наиболее значимых факторов риска сексуальное поведение и спринцевание являются модифицируемыми факторами риска [14]. Однако в нескольких исследованиях была определена распространенность БВ и связанных с ним факторов риска среди женщин в Непале. Таким образом, это исследование было предпринято для оценки связи факторов риска с BV и анализа типа бактерий, связанных с BV.

2. Методы
2.1. Дизайн исследования

Описательное перекрестное исследование было проведено среди 160 небеременных женщин, посещавших больницу медицинского колледжа KIST в течение шести месяцев с ноября 2014 года по май 2015 года.

2.2. Этическое одобрение

Этическое заявление было одобрено этическим комитетом больницы KIST, и было получено устное согласие каждого пациента. Анкеты использовались для сбора социально-демографических, поведенческих характеристик, а также информации о медицинском, репродуктивном и сексуальном анамнезе.

2.3. Сбор и обработка образцов

Зеркало без смазки было вставлено во влагалище для сбора выделений, и был проведен физический осмотр выделений для наблюдения за их формой, цветом, консистенцией и запахом. Затем были взяты два вагинальных образца с помощью стерильных ватных тампонов из бокового и заднего свода влагалища.

Один из тампонов был доставлен в стерильной пробирке с крышкой в ​​микробиологическую лабораторию для аэробных и анаэробных культур в агаре МакКонки, кровяном агаре и шоколадном агаре для идентификации бактериальных изолятов.Первые два агара инокулировали аэробно при 37 ° C в течение 24 часов, а затем анаэробно при 37 ° C в сосуде для свечей в течение 24 часов. Другой тампон использовали для получения мазка для окрашивания по Граму (рисунки 1, 2 и 3) и прямой микроскопии с влажным креплением. Слайды, окрашенные по Граму, исследовали под масляным иммерсионным объективом (увеличение 1000x). Затем подсчитывали этиологический агент и нормальную флору в мазке, окрашенном по Граму, и оценивали в соответствии со стандартизированным методом оценки Ньюджента [18]. (Таблица 1).


cilli 9 9996 904 9 9 9 9 9 9 9 9 9 9 9 9 C 9 9 9 9 9 9 9 9 9 отрицательные бациллы 1 93

Оценка Сумма =-оценка

30 или> 0 0 0 0 0 0 <1 1 <1 1 3
1–4 2 1–4 2 1–4 2 <1 3 5–30 3 5–30 3 8
0 4 30 или> 9049 9 4 30 или> 4 10


Если оценка И Затем сообщите

0–3 Нормальный
4–6 Ключевая ячейка 4–6 Идентификационные клетки присутствуют Бактериальный вагиноз
> 7

9494 овальные жгутиковые простейшие, Trichomonas vaginalis , ключевые клетки и лейкоциты.Для дрожжей проводили окрашивание по Граму и тест на зародышевые трубочки. Candida albicans был идентифицирован по его способности продуцировать зародышевые трубочки при инкубации в сыворотке в течение 2 часов при 37 ° C.

2.4. Статистический анализ

Для расчета распространенности BV и микроорганизмов был проведен описательный анализ. Значения хи-квадрат были рассчитаны на уровне значимости 5% с использованием статистического пакета для социальных наук (SPSS-16).

3. Результаты

При обследовании 160 небеременных женщин с симптоматическими выделениями из влагалища общая распространенность БВ составила 24 человека.4% на основе балльной системы Nugent.

Наибольшее количество случаев BV было зарегистрировано в возрастной группе 30–40 лет (8,8%), а наименьшее количество случаев BV — у пациентов в возрастной группе 10–20 и 50–60 лет (1,3%). Более склонны к БВ незамужние женщины (100%), за ними следуют замужние женщины (24,2%). Неграмотные женщины были самыми высокими — 21,9% от общего числа респондентов. Распространенность БВ была высокой среди фермеров (38,9%) и низкой среди тех, кто занимался предпринимательской деятельностью (14,7%). Более высокая частота БВ наблюдалась среди представителей другой национальности (57.1%), за которыми следуют далиты (50%), брамины (25%), Джанаджати (22,7%) и Чхетри (19,4%) среди всех респондентов. Следовательно, женщины возрастной группы 30–40 лет, незамужние, неграмотные, фермеры и принадлежащие к другим этническим группам были более склонны к БВ (Таблица 2). Однако результат не был статистически значимым при.

6 1 ,5

934 4

Бактериальный вагиноз значение
Число (160186) положительное число

10–20 7 2 (1.3) 5 (3,1) 0,50
20–30 48 13 (8,1) 35 (21,8)
30–40 75 14 (8,8) 61 (38,1)
40–50 22 8 (5)
14 (8,8)
50–60 8 2 (1,3) 6 (3,7)
Семейное положение
Не женат 1 1 (100) 0 (0) 0.32
В браке 153 37 (24,2) 116 (75,8)
Вдовец 5 1 (20) 4 (80)
0 (0) 1 (100)
Неграмотные 55 16 (29,1) 39 (70,9) 0,93
7 1 (14.3) 6 (85,7)
Первичный уровень 27 7 (25,9) 20 (74,1)
Вторичный 41 8 (19,5) 33
Высшее S. 15 3 (20) 12 (80)
Бакалавриат 11 3 (27,3) 8 (72,7)
Магистр 4 Магистр 4 1 (25) 3 (75)
Род занятий
Государственные служащие 23 7 (30.4) 16 (69,6) 0,36
Фермеры 18 7 (38,9) 11 (61,1)
Бизнес 34 5 (14,76) 34 5 (14,76) 90 )
Домохозяйка 81 19 (23,5) 62 (76,5)
Студент 4 1 (25) 3 (75)
Брамин 40 10 (25) 30 (75) 0.24
Чхетри 36 7 (19,4) 29 (80,6)
Джанаджати 75 17 (22,7) 58 (77,3)
1 (50) 1 (50)
Прочие 7 4 (57,1) 3 (42,9)

Джайн и пенджаби / сикх.

Распространенность БВ была выше среди ежедневно курильщиков (30%), тогда как среди курильщиков, которые курили эпизодически, была низкая частота (0%). Ежедневно употребляющие алкоголь имели самую высокую распространенность БВ — 38,5%, наименьшую — 24% — среди тех, кто никогда не употреблял алкоголь, и 16,7% употребляли алкоголь эпизодически. BV был очень высоким среди невегетарианцев — 25,2%, тогда как среди вегетарианцев он составлял только 15,4%. Риск БВ был выше среди тех, кто ежедневно пользовался презервативами (42.9%), чем те, кто иногда пользовался презервативами (29,2%). У женщин, имеющих привычку к ежедневному спринцеванию, вероятность развития БВ была выше (32,1%), чем у женщин со случайной привычкой к спринцеванию (23,7%), и разница была значительной (таблица 3).

) 6 904

93 1899 Nonveg 25,2)

99 650

Бактериальный вагиноз значение
Число (160186) положительное число

Никогда 140 36 (25.71) 104 (74,29) 0,17
Ежедневно 10 3 (30) 7 (70)
Иногда 10 0 (186 0)
Потребление алкоголя
Никогда 129 31 (24) 98 (76) 0,37
Ежедневно 13 9099 61,5)
Иногда 18 3 (16.7) 15 (83,3)
Veg 13 2 (15,4) 11 (84,6) 0,43
110 (74,8)
Использование презервативов
Никогда 129 29 (22,5) 100 (77,5) 0,39
Ежедневно (42.9) 4 (57,1)
Когда-то 24 7 (29,2) 17 (70,8)
Никогда 3899 35 (92,1) 0,015
Ежедневно 84 27 (32,1) 57 (67,9)
Когда-нибудь 38 9 (23,7)

Наибольшая распространенность БВ была обнаружена среди женщин, чей партнер перенес тубэктомию (50%), а наименьшая — среди пользователей ОК (9.1%) (таблица 4).

6 Число (%) 7 (64) 9049 Непользователи

Типы контрацептивов Бактериальный вагиноз значение

Неанатомические участки 0,2
Таблетки OC 11 1 (1) 10 (90,9)
Depo-Provera 17 3 (17,6) 14 (82,4)
Имплантат 5 1 (20)
Анатомические области
Барьерный метод 30 8 (26,7) 22 (73,3)
IUCD 10 3 (304)
Вазэктомия (мужская) 6 3 (50) 3 (50)
Тубэктомия (женская) 11 4 (36) 70 16 (22) 54 (78)

С точки зрения постоянства аномальных выделений из влагалища среди случаев БВ наиболее часто встречались жидкие выделения. (39.8%), а меньше всего — у женщин с нормальными выделениями (4,9%). Грязные выделения наблюдались у (29,9%) пациентов, в то время как нефоловые выделения были обнаружены у (14,3%) пациентов. Избыточные выделения наблюдались у пациентов с БВ (30%), а скудные выделения наблюдались у (18,7%). Было обнаружено, что женщины с БВ связаны с консистенцией, запахом и количеством выделений из влагалища (таблица 5).

,3 ) 93 0,09 93,86 0,80

Вагинальные симптомы Бактериальный вагиноз значение
99 (положительное число) %

Нормальный 61 3 (4.9) 58 (95,1) 0,0001
Тонкий 83 33 (39,8) 50 (60,2)
Толстый 16 3 (18,86) )
Загрязнение 104 31 (29,9) 73 (70,1) 0,02
Не испорченное 56
Белый 126 34 (27) 92 (73) 0.13
Серый 34 5 (14,7) 29 (85,3)
Избыток 80 24 (306)
Скудно 80 15 (18,7) 65 (81,3)
Боль в животе
Да 83 9099 0.51
Нет 77 17 (22,1) 60 (77,9)
Да 56 13 (23,26)
No 104 26 (25) 78 (75)

Всего 99 изолированных бактерий, принадлежащих к 14 видам влагалища образцы, которые приведены в таблице 6.Среди изолятов 41 (32%) были грамотрицательными и 58 (45,3%) были грамположительными. Других изолятов, включая дрожжи и паразитов, было 29 (22,7%). Из грамотрицательных бактерий Pseudomonas spp., E.coli, и Acinetobacter spp. были преобладающими. Lactobacillus spp. были доминирующими грамположительными бактериями, обнаруженными во влагалищных образцах.

6 Staphylococcus aureus 9316 6


Микроорганизмов Количество (%)

9018 coli 9018 colia3)
Klebsiella spp. 4 (3,1)
Proteus vulgaris 1 (0,8)
Proteus mirabilis 4 (3,1)
Pseudomonas spp. 10 (7,8)
Neisseria gonorrhoeae 4 (3,1)
Acinetobacter spp. 8 (6,3)
Citrobacter koseri 1 (0.8)
Enterobacter spp. 1 (0,8)
Streptococcus agalactiae 7 (5,5)
Staphylococcus aureus 9316
Enterococcus spp. 5 (3,9)
Lactobacillus spp. 35 (27.3)
Прочие: (дрожжи и паразиты)
Candida albicans 3 (2.3)
Candida spp. 12 (9,4)
Trichomonas vaginalis 14 (10,9)

4. Обсуждение

генитальных женщин, обращающихся за генитальной помощью, в глобальном масштабе. .Распространенность БВ по методу Ньюджента составила 24,4%. Modak et al. [19] в Индии сообщили о аналогичном результате, предоставив показатель распространенности 24%. Gad et al. Также сообщили о более высоких показателях распространенности БВ, чем в настоящем исследовании. [20] в Египте (33%). Различия в результатах могут быть связаны с размером популяции, методами анализа, географическим распределением, а также социально-экономическими и поведенческими различиями в исследуемой популяции.

Настоящее исследование показало, что распространенность БВ была высокой среди женщин возрастной группы 30-40 лет (8.8%) и минимум для возрастных групп 10–20 и 50–60 лет (1,3%). Однако разница между ними не была статистически значимой. Bhattarai [6] в Непале наблюдал самую высокую распространенность БВ среди возрастной группы 31–40 лет (60,16%) и наименьшую среди лиц моложе 20 лет и возрастной группы 51–60 лет (33,33%), что было аналогично вышеуказанному. изучение. Также Гарба и др. [21] в Нигерии обнаружили, что БВ наиболее распространен в возрастной группе 26–30 лет (35,8%) и меньше всего в возрастной группе старше 40 лет (10,5%). Самая высокая распространенность в возрастной группе 30–40 лет может быть связана с возрастом, который является наиболее репродуктивно активной возрастной группой, и высоким уровнем сексуального контакта в этом возрасте.

Согласно этому исследованию незамужние женщины подвергаются более высокому риску (100% положительных результатов) по сравнению с замужними женщинами (24,2%). Вывод исследования опровергается Gad et al. [20] в Египте. Тем не менее, несколько исследований документально подтвердили возникновение БВ у сексуально неактивных женщин или девственниц [22, 23]. Это свидетельствует о том, что сексуальная активность не является предпосылкой для БВ. Изменение образа жизни, неправильный уход за промежностью, пищевые привычки, тесная одежда, отсутствие внимания к менструальной гигиене и малоподвижный образ жизни могут быть причинами приобретения БВ у незамужних женщин.

Точно так же у неграмотных женщин была самая высокая распространенность БВ — 29,1%, что отличается от данных Ibrahim et al. [24], которые зафиксировали самый высокий показатель распространенности — 54% среди лиц с начальным образованием в Нигерии. Низкий экономический статус, отсутствие образования, отсутствие женщины-консультанта в медицинском центре, нерешительность обращения за медицинской помощью и социокультурная структура могут быть причиной более высокой распространенности БВ среди менее образованных женщин.

В ходе исследования среди фермеров был отмечен более высокий уровень BV, что аналогично результатам исследования, проведенного Garba et al.[21] из Нигерии, которые сообщили о самой высокой распространенности БВ (52,6%) у фермеров. Опять же, величина BV была выше среди женщин другой этнической принадлежности, что отличается от опроса, проведенного в Непале Manandhar et al. [25], которые сообщили о самой высокой распространенности БВ у далитов. Сочетание факторов окружающей среды, контекстуальных и институциональных факторов, а также хронического стресса может способствовать этому несоответствию [15].

Более того, исследование показало, что ежедневные курильщики были более склонны к БВ, чем те, кто никогда не курил, но разница между ними не была значительной, что противоречит результатам исследования, проведенного Manandhar et al.[25] в Непале. Риск BV возрастает с увеличением количества выкуриваемых в день сигарет. Различные химические компоненты сигаретного дыма изменяют микрофлору влагалища или могут действовать, истощая клетки Лангерганса в эпителии шейки матки, что приводит к местной иммуносупрессии, вызывая, таким образом, BV [26]. Исследование показало, что у тех, кто ежедневно употребляет алкоголь, уровень БВ выше (38,5%), чем у тех, кто употребляет алкоголь время от времени, но эта связь не была значительной. Однако результаты согласуются с отчетом Hellberg et al.[27] в Швеции, которые заявили, что употребление алкоголя не было существенно связано с БВ. Курение сигарет и употребление алкоголя вызывают истощение лактобацилл, продуцирующих перекись водорода, что увеличивает риск БВ. Это исследование показало, что у невегетарианцев встречаемость БВ выше (25,2%), чем у вегетарианцев (15,7%), что статистически незначимо. Открытие аналогично открытию Manandhar et al. [25] в Непале. Высокое потребление жиров, особенно насыщенных жиров, может повысить рН влагалища, тем самым увеличивая риск БВ [28].

В этом исследовании распространенность БВ была выше среди женщин, партнеры которых ежедневно пользовались презервативами, чем среди тех, кто не пользовался презервативами. Однако никакой существенной связи обнаружено не было. Результаты более согласуются с исследованием, проведенным Mascarenhas et al. [4] из Бразилии, которые сообщили об отсутствии связи между БВ и использованием презервативов. Одно из возможных объяснений этого заключается в том, что презервативы могут вызывать раздражение, позволяя бактериям проникать во влагалище и повышать риск развития БВ.

Было замечено, что 32.1% случаев BV-положительных были среди женщин, имеющих привычку к ежедневному спринцеванию, и 23,7% были обнаружены положительными для тех женщин, которые иногда имели привычку спринцеваться. Это подтверждает, что вагинальные спринцевания представляют собой фактор риска заражения BV. Предыдущее исследование также показало сильную связь между спринцеванием и БВ [3, 19]. Отсутствие усилий и осведомленности о вреде для здоровья этой неправильной практики можно рассматривать как причину более высокой вероятности БВ среди женщин, привыкших к вагинальному спринцеванию.

Исследование также проясняет, что вероятность заражения BV увеличивается у тех женщин, которые использовали противозачаточные средства на анатомических участках, чем у тех, кто этого не делал. Таким образом, использование противозачаточных средств на анатомических участках может вызвать дисбаланс флоры влагалища и привести к БВ. Самый низкий уровень БВ был отмечен среди женщин, принимавших таблетки ОК (9,1%). Эстроген увеличивает содержание гликогена в активности вагинальных эпителиальных клеток, в свою очередь подавляя рост некоторых бактерий in vitro, что может привести к низкому риску развития BV [16].Точно так же исследование также согласуется с Thulkar et al. [29] в Индии, которые сообщили о защитном эффекте гормональных контрацептивов против BV.

В этом исследовании консистенция, запах и количество выделений из влагалища оказались статистически значимыми для BV. Этот результат соответствует предыдущему исследованию, проведенному Garba et al. [21] в Нигерии. Выделения из влагалища белого цвета имели более высокую распространенность, чем выделения серого цвета, и не были связаны с диагнозом БВ.Определенного цвета выделений из влагалища для диагностики БВ нет; мнения экспертов разошлись, но важно знать, что у женщин с БВ наблюдаются аномальные выделения из влагалища, а выделения из влагалища различаются по консистенции, Garba et al. [21]. Симптомы боли в животе и зуда были обнаружены у 26,6% и 23,2% соответственно, что согласуется с результатами, полученными Nzomo et al. [30] в Кении. Это исследование не выявило значимой связи между болью в животе, зудом и БВ.

Из 128 изолятов 35 изолятов принадлежали к Lactobacillus spp. и 93 изолята были условно-патогенными микроорганизмами. Lactobacillus spp. был выделен как наиболее преобладающий вид и составлял 27,3% от всех бактериальных изолятов. Более высокая распространенность Lactobacillus в этом исследовании также напоминает исследование, проведенное Razzak et al. [31] в Ираке и Ларсен и Мониф [32] в Омахе. Следовательно, Lactobacillus играет защитную и пробиотическую роль в лечении и профилактике вагинальных инфекций, продуцируя антагонистические соединения, и считается безопасным для человека [31].

Вторым распространенным патогеном был Pseudomonas spp., На который приходилось 7,8% случаев BV, за которым следовали многие другие грамотрицательные бактерии, а именно E. coli, Acinetobacter spp. , Proteus spp. , Klebsiella spp. , N. gonorrhoeae, C. koseri и Enterobacter spp. Но результаты исследования противоречат исследованиям, проведенным Razzak et al. [31] в Ираке, Марраццо и др. [33] в Сиэтле и Ларсен и Мониф [32] в Омахе. Pseudomonas spp.является потенциально условно-патогенными бактериями во влагалище и может становиться все более распространенным при незначительных изменениях во влагалищной среде. Он считается первичным патогеном у больных хозяев, госпитализированных пациентов и осложненных инфекций мочевыводящих путей [34]. В совокупности Mumtaz et al. [35] предполагают, что присутствие представителей фекальной флоры во влагалище связано с антисанитарными методами работы с кишечником.

Наиболее распространенными грамположительными кокками в исследовании были Staphylococcus aureus и Streptococcus agalactiae .Заболеваемость составила 5,5% от всех бактериальных изолятов каждый. Это согласуется с выводами Maghsoudi et al. [36] в Пакистане, Tiyyagura et al. [37] в Индии и Аль-Мусави и др. [38] в Ираке. Слизистая оболочка влагалища, колонизированная S. aureus , предрасполагает их к синдрому токсического шока (СТШ). Вторым по распространенности микроорганизмом среди грамположительных кокков были CoNS и Enterococcus spp. что составляет 3,1% и 3,9% соответственно. Вывод аналогичен исследованию, проведенному Masood et al.[39] в Пакистане. CoNS также является обычным вагинальным колонизатором. Он продолжает оставаться самой важной бактериальной причиной бактериального сепсиса и менингита у новорожденных. Энтерококки являются условно-патогенными микроорганизмами и могут вызывать инфекцию при нарушении иммунной системы.

Что касается частоты дрожжевых грибков и паразитов, выделенных от пациентов, Candida albicans (2,3%) и другие Candida spp. (9,4%). Этот результат не согласуется с данными о распространенности кандидозной инфекции Аль-Мук и Хасони [40] в Ираке и аналогичен данным Maghsoudi et al.[36]. T. vaginalis наблюдалась в 14 случаях (10,9%) при приготовлении влажного препарата. Они почти аналогичны исследованию, опубликованному Begum et al. [5] в Дакке (8%).

Уровни этих различных организмов различаются у каждой женщины [41]. Результаты показали, что присутствие лактобацилл вместе с другими условно-патогенными микроорганизмами может быть связано с несколькими факторами, такими как эффекты антибиотиков, тип инкубации (поскольку некоторые виды Lactobacillus не могут продуцировать некоторые защитные факторы при анаэробной инкубации) и антагонизм между ними. lactobacilli для сохранения доминирования [31].Кроме того, в некоторых исследованиях сообщается, что существует вероятность совпадения BV и аэробного вагинита, что приводит к смешанному состоянию, но пока не определено, может ли одно заболевание перерасти в другое [42].

5. Заключение

Исследование предполагает, что использование противозачаточных средств на анатомических участках может повысить риск БВ. Некоторые факторы, особенно вагинальное спринцевание, могут повышать риск БВ. Lactobacillus spp. были преобладающими изолятами, обнаруженными во влагалищном образце, за которыми следовали ряд членов Enterobacteriaceae и грамположительные бактерии.Это открытие предполагает, что колонизация факультативных анаэробов также является более вероятным следствием экологии влагалища. В Непале проводились ограниченные исследования БВ. Таким образом, аналогичные исследования необходимо провести, чтобы улучшить состояние здоровья женщин, тем самым предотвратив риск, связанный с БВ.

Доступность данных

В эту опубликованную статью включены все данные, полученные или проанализированные в ходе текущего исследования.

Дополнительные точки

Ограничение исследования .Большинство анаэробов, связанных с БВ, требовательны и требуют селективно обогащенной среды, и иногда их нелегко идентифицировать с помощью традиционных биохимических тестов. Кроме того, ряд организмов, которые казались связанными с BV, невозможно культивировать, например, виды Eggerthella , Megasphaera и BVAB, входящие в состав Clostridiales. Также было продемонстрировано, что у женщин репродуктивного возраста количество анаэробных бактерий превышает количество аэробных; однако последних оказалось больше с возрастом, началом половой жизни и равенством женщин.2 ноября 2014 г. при наборе персонала.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Вклад авторов

Лабораторные исследования были выполнены Элиза Ранджит и Биджендра Радж Рагхубанши.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *