Стафилококк гемолитический: Стафилококк – симптомы, виды, причины возникновения и лечение заболевания

Содержание

Стафилококк – симптомы, виды, причины возникновения и лечение заболевания

Возбудитель стафилококка — Staphylococcus aureus — это грамположительные неподвижные и не образующие спор анаэробные бактерии, которые имеют округлую форму (форму кокка) и растут гроздьями, поэтому фактически название микроорганизма означает “золотая гроздь винограда”.

О заболевании

При выращивании в чашке Петри с кровяным агаром колонии золотистого стафилококка имеют характерный золотисто-желтый цвет, отсюда и соответствующее название. Этот микроорганизм чрезвычайно распространен, им колонизировано около четверти населения планеты.

Обычно он распространяется в носовой полости, паховой области, подмышках и других частях кожи, но в большинстве случаев является нормальной частью кожной флоры человека и не вызывает никаких проблем.

Однако при увеличении количества бактерий на коже, они начинают проникать в глубокие слои кожи через микротрещины и могут привести к кожным инфекциям и абсцессам.

Патологические процессы могут затрагивать не только различные внутренние органы, такие как печень, почки, селезенка, головной мозг, но и мышцы, кости и суставы, что ведет к крайне плачевным последствиям, поэтому при подозрении на наличие инфекции, следует немедленно обратиться к доктору.

Виды стафилококковых инфекций

Выделяют несколько наиболее распространенных видов стафилококков:

●     Гемолитический стафилококк.

Чаще всего эта инфекция поражает верхние дыхательные пути, вызывая гнойную ангину, фарингит, тонзиллит, бронхит и другие воспалительные заболевания. Данные бактерии очень устойчивы и трудно поддаются терапии.

●     Золотистый.

Данный микроорганизм чрезвычайно устойчив почти ко всем видам антибиотиков пенициллинового ряда, антисептикам, высоким температурам, активным прямым солнечным лучам. Он вызывает различные поражения кожи, такие как экзема, абсцесс, фурункулы, поражения желудочно-кишечного тракта, верхних дыхательных путей, слизистых оболочек, в худшем случае приводит к токсическому шоку.

●     Эпидермальный.

Этот микроорганизм обитает на поверхности кожи и слизистых любого здорового человека и не несет никакого вреда. Но, если эта бактерия попадает в кровь человека с ослабленным иммунитетом, что чаще всего происходит при хирургических операциях, использовании неправильно обработанных инструментов, катетеров, происходит заражение крови, что ведет к воспалению внутренней оболочки сердца.

●     Сапрофитный.

Несмотря на то, что этот вид наименее опасный, при заражении он приводит к общей интоксикации организма, вследствие выделения опасных токсинов и ферментов в процессе своей жизнедеятельности. Данные микроорганизмы часто становятся возбудителями воспаления уретры и мочевого пузыря. Преимущественно это характерно для женщин в силу анатомических особенностей строения их мочеполовой системы. При отсутствии лечения цистит влечет за собой воспаление почек и проблемы с зачатием ребенка.

Симптомы и формы стафилококка у взрослых и детей

Симптомы, которые ощущает больной, сильно разнятся в зависимости от способа и места инфицирования и состояния иммунитета. Но можно выделить ряд наиболее характерных признаков:

●     повышенная температура;

●     нагноение порезов, отечность, гнойные высыпания на коже и слизистых, зуд и покраснение глаз;

●     отсутствие обоняния и носового дыхания;

●     першение в горле, болезненность при глотании, сухой кашель;

●     тошнота, рвота, общее ослабленное состояние;

●     сильные головные боли, приступы эпилепсии, сильная одышка;

●     болезненные ощущения в суставах.

Одной из самых распространенных форм стафилококков у взрослых людей является его бессимптомное носительство. Здоровый человек не ощущает каких-либо признаков заболевания до тех пор, пока не появится провоцирующий фактор, который даст толчок развитию болезни.

Для женщин наиболее опасен сапрофитная форма, способная привести к возникновению цистита. Это связано с тем, что уретра женщин располагается очень близко к влагалищу, из-за чего велика вероятность попадания патогенной микрофлоры, в том числе и палочки стафилококка, в уретральный канал, а затем и в мочевой пузырь, вызывая его воспаление.

Так как маленькие дети не обладают окрепшей иммунной системой, риск развития инфекции у ребенка достаточно велик. Причем привести к серьезным осложнениям у детей могут даже те виды стафилококка, которые во взрослом возрасте практически не вызывают проблем. Особенную опасность представляет стафилококк у детей в возрасте до года, так как он с легкостью, в кратчайшие сроки способен распространиться по организму и привести к серьезным последствиям вплоть до летального исхода.

Причины возникновения

Наиболее часто бактерия попадает в организм человека через ранки и микротрещины на коже. Инфекция, проникнув через рану, начинает размножаться в крови, распространяясь по организму и поражая легкие, сердце, мозг, печень, почки, суставы.

При стафилококке заболевания могут быть самые различные такие, как пневмония, менингит, остеомиелит, эндокардит, сепсис и многие другие.

Заражение инфекцией стафилококк может произойти следующими способами:

●     Контактно-бытовым путем при использовании личных предметов больного;

●     Воздушно-капельным при близком общении с зараженным;

●     Фекально-оральным на грязных фруктах, овощах и других продуктах питания, грязных посуде и руках;

●     Вертикальным при прохождении ребенка через родовые пути зараженной матери при родах.

●     Нередко инфицирование происходит во время хирургического вмешательства через медицинский инструментарий и во время проведения различных манипуляций.

Диагностика

Диагностировать наличие инфекции может только врач по результатам проведенного анализа на стафилококк.

Стоит помнить, что проведение анализа рекомендуется только, если присутствуют симптомы болезни. Наличие бактерии в биологическом материале может означать то, что человек является ее носителем, что само по себе является нормой.

Для анализа осуществляется забор материала из области, где предположительно развивается инфекция. Чтобы обнаружить патологический процесс проводятся несколько тестов, чтобы отследить динамику размножения бактерий. Если их число стремительно увеличивается, можно диагностировать наличие стафилококковой инфекции. Также дополнительный анализ позволит определить конкретный вид инфекции, чтобы доктор смог подобрать персональную схему лечения.

Лечение

Лечение стафилококка может проводиться хирургическим способом при наличии гнойного поражения в области заражения. Также может потребоваться удалить инфицированный имплант, катетер и пр.

В качестве консервативного лечения стафилококка применяют антибиотики, антибактериальные средства в сочетании с иммуномодулирующей терапией. Препараты подбираются с учетом устойчивости стафилококка к большому ряду медикаментов. Большую эффективность показало применение бриллиантового зеленого раствора для обработки зараженных ран.

Какие анализы необходимо сдать

В первую очередь, для определения наличия инфекции сдается анализ на стафилококк.

При заболеваниях дыхательных путей сдают мазок из носо- и-ротоглотки, при цистите — мочу, при расстройстве ЖКТ — кал, при кожных поражениях — соскоб с кожи, а, если есть подозрения на обширное заражение, сдают кровь.

Также перед тем как начать лечение с применением антибиотиков, требуется сдать анализ на резистентность к этим медикаментам.

К какому врачу обращаться

Запущенными случаями заболевания занимается инфекционисту.

Но если у вас только появились подозрения и вы хотите получить точный диагноз, для начала вам следует обратиться к терапевту, с детьми – к педиатру. Доктор проведет диагностику и на основании полученных результатов выпишет вам направление к необходимому врачу.

Профилактика стафилококка

Главной мерой профилактики заражения стафилококком является постоянное соблюдение правил гигиены. После пребывания в общественных местах или контакта с предметами общественного пользования необходимо тщательно мыть руки с мылом. Также важно не контактировать с главным источником заражения стафилококком — больными людьми.

Как предотвратить заболевание

Чтобы предотвратить распространение стафилококка в организме и последующее развитие болезни, необходимо укреплять иммунитет. Для этого рекомендуется вести здоровый образ жизни, заниматься физической активностью, правильно питаться, соблюдая баланс витаминов и всех необходимых микроэлементов, потреблять достаточное количество воды.

Крепкий иммунитет сдержит активность патогенного микроорганизма в пределах безопасной нормы.

Будьте здоровы, дорогие пациенты!

Записаться на прием

Введите пожалуйста свои данные


Стафилококк: что это, симптомы, причины, лечение

Что это такое?

Стафилококки — род анаэробных шарообразных бактерий, которые вызывают пневмонию, эндокардит, ряд инфекций кожи, остеомиелит, менингит, септический артрит, синдром токсического шока и другие заболевания. Бактерии постоянно обитают на кожных покровах здорового человека, его носоглотке и ротоглотке. Инфицирование происходит при снижении иммунитета.

Особенно подвержены стафилококковой инфекции новорожденные дети и кормящие женщины, пациенты со сниженным иммунитетом, в том числе болеющие гриппом, опухолями, лейкемией, хроническими лёгочными недугами, пребывающие на диализе, инъекционные наркоманы, люди с трансплантатами и протезами, с открытыми ранами, ожогами, хирургическими разрезами.

Чаще всего стафилококки передаются воздушно-капельным или контактным путём.

Наиболее патогенен для человека золотистый стафилококк, приводящий к воспалительным процессам и нагноению практически всех органов человека. «Золотистым» он называется из-за образования золотистого пигмента. Однако это не единственный вид бактерий. Помимо него, у пациентов встречаются:

  • эпидермальный стафилококк;
  • сапрофитный, приводящий к циститу и уретриту;
  • гемолитический, поражающий кожный покров и нередко приводящий к сепсису.

Симптомы инфицирования

Симптоматика широко варьируется в зависимости от поражённого органа, иммунитета пациента, его возраста. Бывают случаи бессимптомной бактериемии, когда микроорганизмы обнаруживаются в крови, но не доставляют беспокойства и не влияют на функционирование органов.

Однако наиболее распространённые симптомы могут включать в себя:

  • образование на кожных покровах гнойничков и карбункулов;
  • стоматит, конъюнктивит и другие локальные воспаления;
  • появление высыпаний на коже, сопровождаемых зудом;
  • повышение температуры тела, лихорадка;
  • ухудшение аппетита, общая слабость и апатия;
  • проблемы с ЖКТ: тошнота, рвота, метеоризм, диарея;
  • покраснение горла и увеличение миндалин — симптоматика ангины.

Поскольку стафилококки могут поразить любой орган, симптомы тоже могут различаться.

Причины развития стафилококковой инфекции

Главная причина развития заболевания — снижение иммунитета из-за стресса, болезней, неправильного питания, авитаминоза или приёма лекарственных препаратов. Падение иммунитета, в том числе сезонное, может спровоцировать размножение бактерий и последующее инфицирование.

Есть и другие причины:

  • несоблюдение рекомендаций врача при уходе за ранами, ссадинами и травмами;
  • тесное взаимодействие с носителем инфекции, например, с болеющим ангиной членом семьи;
  • употребление плохо обработанных продуктов питания — бактерии могут передаваться через пищу.

Младенцы инфицируются из-за патологий во время беременности и родов, к примеру, длительного безводного периода, недоношенности, несоблюдения гигиены.

Из-за особенностей способов передачи стафилококковую бактериемию сравнительно легко предотвратить, соблюдая базовые требования по гигиене, не взаимодействуя с чужими личными вещами, соблюдая рекомендации врача и избегая — по возможности — тесного общения с инфицированными.

Диагностика и лечение

Диагностика заболевания включает в себя:

  • стандартные клинические анализы крови, биохимия;
  • бакпосев для определения конкретного вида стафилококка;
  • иммуноферментный анализ ИФА, который поможет определить наличие антител.

Могут понадобиться исследования, касающиеся конкретного затронутого инфекцией органа.

Лечение — антибиотикотерапия с подбором лекарства под конкретный возбудитель. Это важно, поскольку среди бактерий стафилококкового рода встречаются резистентные к стандартным лекарствам, требующие особого подхода. Очень важно не «назначать» себе антибиотики самостоятельно — это чрезвычайно сильные и опасные лекарственные средства, прописать которые может только дерматолог.

Дополнительно могут назначаться средства для симптоматического лечения, например, мази для обработки гнойников и язв, жаропонижающие средства.

Угревая болезнь: клинико–иммуно–микробиологические аспекты | Васильева Е.С.

Здоровье кожи в значительной мере определяется состоянием ее симбиотической микрофлоры. Бла­годаря кооперации и метаболической активности симбионтная микрофлора кожи у здорового человека противодействует ее колонизации патогенными микроорганизмами. «Колонизационная резистент­ность» кожных покровов обеспечивается механизмами, связанными с организмом хозяина (продукция жирных кислот, иммуноглобулинов, лизоцима и др.), а также с образованием кожной микрофлорой разнообразных микробных агентов (органические кислоты, бактериоцины, перекиси, антибиотики и т.д.) [2,6]. Анализ данных литературы свидетельствует, что у больных акне имеются глубокие нарушения количественного и качественного состава микрофлоры кожи [2–5,11]. Наиболее выраженные изменения проявляются в увеличении количественного содержания на коже Staphylococcus аureus и Staphylo­coccus haemoliticus [5,6] и уменьшении содержания эпидермальных стафилококков, пропионибактерий и других представителей нормофлоры кожи [1,8,10]. Выде­ленные при акне патогенные и оппортунистические микробы, как показывают данные литературы, часто обладают устойчивостью к антибактериальным средствам (например, резистентность к эритромицину у Staphylococcus epidermidis составляет 95%, у Propio­ni­bacterium acnes – 52% [9]) и повышенным патогенным потенциалом [6,12–15].

Цель исследования: оценка состава микрофлоры кожи у больных с вялотекущими, торпидными формами акне и исследование чувствительности к наиболее часто применяемым при этой патологии антимикробным средствам.
Материалы и методы. Было обследовано 137 больных с воспалительными формами угревой болезни, которые отмечали неэффективность проводимого ранее лечения.
Согласно классификации Pochi P.E. et al. (1991) были выделены основные клинические формы заболевания: папуло–пустулезная – 104 пациента (76%) и узловатая – 33 больных (24%).
Степень тяжести заболевания определяли по методу С.Н. Соок et al. (1979) в модификации B.S. Allen, J.G. Smith (1982), на основании шкалы от 0 до 8 в зависимости от выраженности акне–элементов, их количества и площади поражения. У наблюдаемых больных отмечалась средняя и тяжелая степени тяжести, о чем свидетельствуют градации 4–6 и градации 7–8 по шкале Кука. Средняя степень тяжести преобладала у 115 (84%) больных папуло–пустулезной формой акне и у 86 (63%) – узловатой.
Возраст пациентов составил от 18 до 34 лет, давность заболевания от 5 до 12 лет. Больные на протяжении 1,5–3 лет неоднократно получали антимикробные препараты как местно, так и системно, но без клинического эффекта. Наиболее часто использовались эритромицин и доксициклин.
Объектом исследования явилась кожа лица в областях поражения до лечения и идентичные по локализации участки кожи через неделю после лечения. Взятие материала осуществлялось следующим образом: 1–2 воспалительных очага с визуально выявляемыми признаками гнойного воспаления вскрывались стерильной иглой. Шпателем осуществляли надавливание на пустулы и содержимое выдавливали на стерильный ватный тампон. Тампоны тотчас доставлялись в микробиологическую лабораторию в течение 2 часов после взятия материала. Изоляция микроорганизмов из представленного биоматериала осуществлялась в микробиологической лаборатории Больницы гражданской авиации. Посев, культивирование и идентификацию микроорганизмов проводили в соответствии с приказом МЗ СССР № 535 от 22 апреля 1985 г. «Об унификации микробиологических (бактериологических) методов исследования, применяемых в клинико–диагностических лабораториях лечебно–профилактических учреждений».
Посевы бактериологического материала проводили в аэробных и анаэробных условиях количественным или полуколичественным методом на плотные и жидкие питательные среды (Приказ Минздрава СССР № 535, 1985 г.; Mannual of Clinical Microbiology, 1999). Для по­лу­чения изолированных колоний использовали модификацию рассева по Дригальски. Идентификацию аэроб­ной и анаэробной флоры проводили с помощью «рутинных» методик (постановка «пестрого ряда» на 12 тестах или на микробиологическом анализаторе с автоматизированной системой i EMS Reader, Labsys­tems, Финляндия, с использованием планшет: СТАФИ–тест 16, НФЕРМ–тест 24, СТРЕПТО–тест 16, ЭНТЕРО–тест 16 производства «PLIVA–Lachema», Чехия). Использовали программы: «МИКРОБ» и «МИКРОБ–АВТОМАТ».
Предварительные результаты оценивали в день забора материала и через 24–48 часов при первичном просмотре чашек. Окончательный ответ с результатами идентификации и постановкой чувствительности к антибактериальным препаратам получали на 5–6–е сутки.
Определение чувствительности к антибиотикам проводили в соответствии с методическими указаниями МУК 4.2.1890–04 «Определение чувствительности микроорганизмов к антибактериальным препаратам» (2004), а также руководствуясь стандартами Нацио­наль­ного комитета по клиническим лабораторным стандартам США (с 2005 года – Институт клинических и ла­бо­раторных стандартов) – диско–диффузионным ме­то­дом на агаре Мюллера–Хинтона (тест Кирби и Бауэ­ра) в соответствии с руководством по микробиологии «Меди­цин­ская Микробиология» (1998) с помощью коммерческих план­шет производства ЗАО «Ставро­поль» и автоматизированной программы «МИКРОБ– АВТОМАТ». Ис­поль­зовались диски для определения чувствительности к антибиотикам: эритромицину, доксициклину, тетрациклину, азитромицину, линкомицину. Количество выросших бактерий выражали в колониеобразующих единицах (КОЕ) на 1 мл патологического материала [7].
Результаты и обсуждение. Проведенное микробиологическое исследование позволило выделить из очагов поражения 184 штамма бактерий, из которых наиболее часто определялись в чистой культуре (всего 90 штаммов) штаммы гемолитического стафилококка (65 штаммов) и золотистого стафилококка (18 штаммов). Кроме того, были получены 94 штамма, обусловившие смешанный рост культур (2–3 и более). Встре­ча­лись комбинации стафилококков с Peptostreptococcus anaerobius, S. epider­midis, Neisseria sicca, Propionibacterium acnes.
Все микроорганизмы при первичном исследовании высевались в концентрациях более чем 104 КОЕ/мл.
Выводы: Анализ полученных результатов подтвердил данные литературы, что у больных с пустулезными формами акне из воспалительных элементов выделя­ются гемолитический и золотистый стафилококки (табл. 1). Результаты наших исследований впервые по­ка­зали, что у больных с упорно протекающим, торпидным к проводимому лечению течением дерматоза преобладающим возбудителем является Staph. haemoliticus (72%), в меньшей степени – Staph. аureus (20%), причем они выявлялись в 3–4 раза чаще других микроорганизмов. Кроме того, помимо Staph. аureus и Staph. haemoliticus, у части больных (8% случаев) выделялся пиогенный стрептококк (Streptococcus pyogenes).
Наиболее часто выделяемый у больных акне (табл. 2) гемолитический стафилококк в 78,6% случаев резистентен к эритромицину, в 48% случаев отмечается резистентность к доксициклину, в 76,7% – к тетрациклину, т.е. к тем антимикробным препаратам, которые в настоящее время традиционно используются в практической косметологии [8,9,11] для лечения больных. Эти данные позволяют нам высказать предположение, что одной из причин хронизации дерматоза и неэффективности проводимого лечения является широкое распространение антибиотикорезистентности среди основных возбудителей.
В связи с вышеизложенным считаем целесообразным:
1. Обязательное определение чувствительности к антибиотикам у всех больных; выбор антибактериального средства осуществлять с учетом этих данных.
2. Изыскание новых антимикробных средств.
3. Более широкое использование альтернативных методов лечения акне, осложненных гнойно–воспали­тель­ным процессом, к каковым можно отнести физиотерапевтические методы, иммуностимулирующие средства, использование пробиотических препаратов, содержащих микроорганизмы и проявляющих выраженную антагонистическую активность в отношении Staph. aureus и Staph. haemoliticus.

Литература
1. Донецкая С.В. Обоснование тактики лечения вульгарных угрей на основании изучения индивидуальных особенностей корреляции общего и местного иммунитета. Дис… канд. мед. наук. – М., 1997. – 113 с.
2. Иванов А.А. Микроэкология кожи человека и ее взаимосвязь с иммунным статусом человека //Мат. науч.–практ. конф. «Микрофлора кожи человека – клинико–диагностическое значение». – М., 1989. – С.3–11.
3. Клемпарская Н.Н. Изменение микрофлоры кожи при действии на организм экзогенных и эндогенных факторов // Мат. науч.–практ. конф. «Микрофлора кожи человека – клинико–диагностическое значение». – М., 1989. – С.12–23.
4. Ковалев В.М. Методы комплексной терапии угревой болезни в свете новых данных о патогенетической роли нарушений содержания простагландина Е 2 и циклического 3, 5–аденозинмонофосфата., 1983, Дис… к.м.н.
5. Кутасевич Я.Ф., Маштакова И.А., Багмет А.Н., Шаповалова О.В. Микробиоценоз кожи у больных угревой болезнью и пути его коррекции. Украiнський журнал дерматолог, венеролог, косметолог. №1, березень 2003.– 43–47 с.
6. Нобл У.К. Микробиология кожи человека. – М.: Медицина, 1986. – 496 С.
7. Фельдман Ю.М., Миханева Л.Г., Шапиро А.В., Кузьменко В.Д. Ко­ли­чественное определение бактерий в клинических материалах // Лаб. дело. – 1984.– №10.– С. 616–619.
8. Braun–Falco O., G. Plewig, H.H. Wolff, W.H.C. Burgdorf Dermatology, 2000; P. 1054–1055.
9. Dreno B, Reynaud A, Moyse D, Habert H, Richet H. Erythromycin– Resistance of cutaneous bacterial flora in acne. Eur. J. Dermatol. 2001. Nov–Dec; 11(6): 549–53.
10. Holland K. T., Aldana O., Bojar R.A., Cunllife W.J., Eady E.A. Propionibacterium acnes and Acne. // Dermatology, 1998; P. 196: 67–68.
11. Kennet A. Arndt, Kathryn E. Bowers. Manual of Dermatologic Therapeutics. LWW, 2002.p.3–20.
12. Leeming J.P., Holland K.T., Cunliffe W.J. The microbial colonization of inflamed acne vulgaris lesions. Brit. J. Derm., 1988, 118 (2), 203–8.
13. Plewig G., Kligman A.M. Acne: Morphogenesis and Treatment. Berlin: Springer, 1975.
14. Plewig G., Kligman A.M. Acne: Pathogenesis; Morphologie; Therapie. Berlin etr., Springer, 1978, 348 p.
15. Webster G.F. Acne vulgaris. Clinical review. B M J 2002; Volum 325: 475–9.

.

Порекомендуйте статью вашим коллегам

Опасность золотистого стафилококка и методы его лечения

Лечение золотистого стафилококка

Стафилококки – это широко распространенные в природе микробы, являющиеся обитателями том числе и тела человека. Их относят к условно-патогенной флоре, при обычных условиях никак не влияющей на жизнь и здоровье человека. Но стафилококк имеет особые свойства, он может формировать патогенные штаммы (особенно опасны внутрибольничные, устойчивые к антибиотикам и особо агрессивные). Также, при снижении иммунной защиты организма или попадании в нетипичную для его обитания среду организма, стафилококк может давать инфекционный процесс.

Стафилококк: виды и свойства

Обычно стафилококк обитает на поверхности кожных покровов и слизистых человека, не причиняя ему вреда. У детей раннего возраста, ослабленных больных или при изменении патогенных свойств, стафилококк способен проявлять свои патогенные свойства. В виду того, что штаммов стафилококка очень много, у них выявляется разная степень опасности для организма.

К особо важным в отношении заболеваемости, относят несколько видов стафилококка – гемолитический, эпидермальный, сапрофитный или золотистый стафилококк. Особыми свойствами данных микробов является наличие у них особых ферментов и выделяемых токсинов, которые приводят к повреждению клеток и нарушению обменных процессов организма. стафилококки могут негативно влиять на кожные покровы и слизистые, подкожную клетчатку, провоцируют поражения дыхательной системы и легочной ткани, поражения кишечника и почек, а также генерализованные состояния в виде сепсиса, токсинового шока и поражений головного и спинного мозга. Зачастую стафилококковые инфекции имеют вторичное происхождение, наслаиваясь на основное заболевание и давая гнойные осложнения. Они обладают достаточной устойчивостью к средствам дезинфекции и многим антибиотикам, виду чего ними порой крайне сложно бороться.

Золотистый стафилококк

Этот вид микроба относят к одним из самых распространенных и самым опасным в плане гнойно-септических осложнений. Им могут поражаться люди всех возрастов от младенцев до стариков, часто именно этот вид провоцирует вспышки внутрибольничных инфекций, приобретая особо патогенные свойства. Золотистый стафилококк способен поражать любые органы и ткани тела, провоцировать различные гнойно-воспалительные поражения. Микроб обладает высокой устойчивостью к действию дезинфекции, антисептических препаратов и многих антибиотиков. За счет него провоцируются кожные процессы в виде ячменей, фурункулов, абсцессов и флегмон. Он может давать гнойные поражения костей, абсцессов мозга, поражения сердца и почек, а также пищевые токсикоинфекции.

Стафилококк: лечение

Основу лечения стафилококковой инфекции составляют антибиотики. Однако, в виду того, что многие штаммы обладают устойчивостью к традиционным и широко применимым препаратам, терапия может осложняться из-за ограниченности выбора медикаментов. Если выявлен стафилококк, лечение проводят пор результатам посева и определения чувствительности микроба к антибиотикам. Применимы препараты пенициллинового ряда, защищенные и нового поколения, а также цефалоспорины. В некоторых случаях применимы препараты аминогликозидов и макролидов, либо, при развитии внутрибольничных штаммов – антибиотики резерва.

Дополняет лечение введение анти-стафилококкового иммуноглобулина, гипериммунной плазмы и дотоксикация. При наличии гнойных полостей, необходима их хирургическая обработка с удалением гноя и промыванием растворами антисептиков.

Не смотря на успехи медицины в лечении гнойных инфекций, стафилококк остается актуальной проблемой медицины в виду его особых свойств. На сегодня летальность от данной инфекции все еще очень высока.

18+

Имеются противопоказания. Необходима консультация специалиста.


На правах рекламы

Стафилококкозы собак — Ветеринария и жизнь

Большое количество возбудителей в окружающей среде значительно усложняют жизнь домашних животных, в частности собаководов. Оградить животное от всех патогенов невозможно. 

Поэтому, необходимо знать, как проявляются признаки заражения теми или иными микроорганизмами, в частности, патогенными стафилококками, и как лечить отдельно взятую инфекцию. Особенно распространены среди собак стафилококкозы.

Стафилококкозы — это группа заболеваний, причиной которых являются патогенные стафилококки видов: Staphylococcus aureus, Staphylococcus haemolyticus, Staphylococcus intermedius, Staphylococcus pseudintermedius, Staphylococcus epidermidis. Патология может развиваться по двум основным путям. Первый заключается в том, что стафилококк самостоятельно вызывает заболевание. В том случае, если он присоединяется к уже существующей проблеме, речь ведут о вторичной форме. Таким образом, стафилококк у собак может поражать различные органы (кожу, глаза, уши, слизистые оболочки носовой и ротовой полостей, мочеполовую систему, кровь и др.), но благодаря тому, что имеются характерные симптомы, можно вовремя заметить заболевание и начать лечение.

Стафилококк относится к грамположительным микроорганизмам. Он имеет шаровидную форму и определяется в виде скоплений, напоминающих гроздь винограда. Название бактерий возникло от лат. Staphylococcus, от греч. σταφυλή — «гроздь винограда» и греч. κόκκος — «зерно, ягода».
У каждой собаки имеется своя предрасположенность к возбудителю или же напротив, устойчивость. 

При высокой сопротивляемости организма для инфицирования необходима огромная доза заражения.

В то же время, следует выделить основные предрасполагающие факторы, способствующие заболеванию:

— высокий уровень углеводов в организме собак;
— нарушение иммунитета;
— авитаминозы, а точнее недостаток витаминов A, E, группы В;
— отравление организма;
— заболевания кожи, в частности, клещи,блохи, аллергические реакции и пр.;
— настроенность иммунной системы в виде отсутствия устойчивости именно к этому возбудителю.

Практически все симптомы, которые вызывает стафилококк, связаны с состоянием кожи. Возможно, это объясняется тем, что у животного кожа не способна выполнять защитную функцию также эффективно, как, например, кожа человека. Наиболее часто регистрируется пиодермия, вызвать которую могут: золотистый стафилококк, гемолитический, псевдоинтермедиус и интермедиус, иногда эпидермальный стафилококк. Данная патология классифицируется в зависимости от того, на какую глубину распространяется патологический процесс. Поверхностная форма выражается в виде появления неглубоких эрозий и не сильно выраженного зуда. Прикосновение к ним вызывает болевые ощущения. Данная форма может быть с появлением влажных эрозий. Их провоцирует травма кожи или постоянное расчесывание вследствие наличия паразитов на коже собаки. Наиболее часто при этом золотистый стафилококк выявляется в области хвоста, на шее, под грудью и на лапах, в тех местах, где кожа наиболее тонкая и, следовательно, более уязвимая. Обострение заболевания может быть летом или весной, то есть в теплое время года.

Кроме этого пиодермия с поверхностным поражением кожи может регистрироваться у собак с выраженными кожными складками. В процессе жизнедеятельности в них скапливаются различные выделения и остатки корма. При отсутствии проветривания присоединяется инфекция, которой, как правило, и являются патогенные виды стафилококков.

Помимо кожного покрова, у собак стафилококк может поражать и слизистые оболочки ротовой полости, глаз, репродуктивных органов; уши.

Есть еще один симптом, который часто регистрируется у собак и не всегда владельцы догадываются, что его причиной также является стафилококк. Речь идет об отитах. Это может быть скрытое течение или бурно протекающая болезнь. В некоторых случаях патология поражает даже ткани внутреннего уха, что проявляется в виде язв и эрозий. Если данную патологию вовремя не вылечить, то может присоединиться конъюнктивит и ринит.

Чтобы распознать у собаки стафилококкоз, необходимо как можно раньше обратиться к врачу при появлении первых симптомов.

Основой диагностики стафилококкоза является бактериологический анализ. В качестве патологического материала в лабораторию направляют: пробы гноя, мокроты, смывы из носа, рта, дёсен, ушей и конъюнктивы, кровь, испражнения, пунктат из уха, соскобы с кожи, материалом для бактериологического исследования могут также служить пробы корма.

Специалисты ФГБУ «Краснодарская МВЛ» проводят диагностику стафилококкозов собак при помощи классических бактериологических методов, а также импортных тест-систем. Срок исследования составляет 4-5 дней. 

Своевременно поставленный диагноз позволит грамотно провести лечение с учётом чувствительности выделенной культуры стафилококка к антибактериальным препаратам, получить лечебный эффект.

Источник: пресс-служба ФГБУ «Краснодарская МВЛ»

Подпишитесь на нас в ЯНДЕКС.НОВОСТИ и в Telegram , чтобы читать новости сразу, как только они появляются на сайте.

Фенотипическая характеристика биологических свойств коагулазонегативных стафилококков, выделенных в кардиохирургическом стационаре | Граничная

1. Казачек ЯВ, Помешкина СА, Барбараш ОЛ. Профилактика инфекционных осложнений в кардиохирургии. Комплексные проблемы сердечно-сосудистых заболеваний. 2014;(4): 62–9. doi: http://dx.doi.org/10.17802/23061278-2014-4-62-69.

2. Кузнецов МС, Козлов БН, Насрашвили ГГ, Панфилов ДС, Андриянова АВ, Петлин КА, Шипулин ВМ. Сравнительный анализ результатов применения методик элиминации стернальной инфекции в кардиохирургии. Клиническая и экспериментальная хирургия. Журнал имени академика Б.В. Петровского. 2016;(2):51–9.

3. Гостев ВВ, Гончаров АЕ, Грачева МА, Сидоренко СВ. Распространение генов комплекса Immune evasion cluster и других факторов вирулентности у Staphylococcus aureus. Клиническая микробиология и антимикробная химиотерапия. 2013;15(4):270–8.

4. Фалова ОЕ. Особенности лецитиназной активности Staphylococcus spp. Международный журнал прикладных и фундаментальных исследований. 2013;(8–3):112–3.

5. Чуенко ЭА, Усвяцов БЯ. Характеристика антикарнозиновой активности разных видов стафилококков. Вестник Оренбургского государственного университета. 2005;(12):63–5.

6. Tegnell A, Arén C, Ohman L. Coagulase-negative staphylococci and sternal infections after cardiac operation. Ann Thorac Surg. 2000;69(4): 1104–9. doi: http://dx.doi.org/10.1016/S0003-4975(99)01563-5.

7. Богомолова НС, Большаков ЛВ, Кузнецова СМ, Орешкина ТД. Динамика устойчивости к антибиотикам и частота выделения стафилококков и энтерококков у больных отделения реконструктивной хирургии. Антибиотики и химиотерапия. 2011;56(5–6):37–45.

8. Rupp ME, Archer GL. Coagulase-negative staphylococci: pathogens associated with medical progress. Clin Infect Dis. 1994;19(2): 231–43.

9. Piette A, Verschraegen G. Role of coagulase-negative staphylococci in human disease. Vet Microbiol. 2009;134(1–2):45–54. doi:10.1016/j.vetmic.2008.09.009.

10. Ishak MA, Gröschel DH, Mandell GL, Wenzel RP. Association of slime with pathogenicity of coagulase-negative staphylococci causing nosocomial septicemia. J Clin Microbiol. 1985;22(6):1025–9. doi:0095-1137/85/121025-05$02.00/0.

11. Козлова НС, Баранцевич НЕ, Иванова ЛВ, Гоик ВГ, Шварц АП, Мокрова ЕВ, Баранцевич ЕП. Чувствительность к антибактериальным препаратам стафилококков, циркулирующих в многопрофильном стационаре. Проблемы медицинской микологии. 2015;17(4):58–62.

12. Шаркова ВА, Лайман ЕФ. Генетические маркеры патогенности и антибиотикорезистентности штаммов S. epidermidis и S. aureus, изолированных из различных биотопов. Дальневосточный медицинский журнал. 2013;(3):28–31.

13. Флуер ФС. Стафилококковые энтеротоксины, их свойства и роль в качестве факторов патогенности. Журнал микробиологии, эпидемиологии и иммунобиологии. 2012;(2): 99–108.

14. Seiberling KA, Conley DB, Tripathi A, Grammer LC, Shuh L, Haines GK 3rd, Schleimer R, Kern RC. Superantigens and chronic rhinosinusitis: detection of staphylococcal exotoxins in nasal polyps. Laryngoscope. 2005;115(9):1580–5. doi:10.1097/01.mlg.0000168111.11802.9c.

15. Стукова ЕИ, Кениксфест ЮВ. Патогенетическое значение золотистого стафилококка при атопическом дерматите. Фундаментальные исследования. 2013;(7–3):680–7.

16. Баязитова ЛТ, Тюрин ЮА, Сукманская ЕО, Куликов СН. Фенотипические характеристики кокковой микрофлоры кожи при атопическом дерматите. Практическая медицина. 2007;(4):41–3.

17. Huvenne W, Hellings PW, Bachert C. Role of staphylococcal superantigens in airway disease. Int Arch Allergy Immunol. 2013;161(4): 304–14. doi:10.1159/000350329.

18. Коленчукова ОА, Смирнова СВ, Лаптева АМ. Количественный и качественный состав микрофлоры слизистой оболочки носа при полипозном риносинусите. Инфекция и иммунитет. 2016;6(4):366–72. doi: http://dx.doi.org/10.15789/2220-7619-2016-4-366-372.

Бесплатные консультации врачей онлайн

Вопрос создается. Пожалуйста, подождите…

Только зарегистрированные пользователи могу задавать вопрос.
Зарегистрируйтесь на портале, задавайте вопросы и получайте ответы от квалифицированных специалистов!

Напоминаем, что стоимость публикации вопроса — 10 бонусов.

Зарегистрироваться Как получить бонусы

К сожалению, у вас недостаточно бонусов для оплаты вопроса.
Напоминаем, что стоимость публикации вопроса — 10 бонусов.

Как получить бонусы

Раздел медицины*: — Не указано —КоронавирусАкушерствоАллергология, иммунологияАнестезиологияВенерологияВертебрологияВетеринарияГастроэнтерологияГематологияГепатологияГериатрияГинекологияГирудотерапияГомеопатияДерматологияДиетологияИглотерапия и РефлексотерапияИнфекционные и паразитарные болезниКардиологияКардиохирургияКосметологияЛабораторная и функциональная диагностикаЛечение травмЛогопедияМаммологияМануальная терапияМРТ, КТ диагностикаНаркологияНеврологияНейрохирургияНетрадиционные методы леченияНефрологияОбщая хирургияОнкологияОстеопатияОториноларингологияОфтальмологияПедиатрияПлазмаферезПластическая хирургияПодологияПроктологияПсихиатрияПсихологияПсихотерапияПульмонология, фтизиатрияРадиология и лучевая терапияРеабилитологияРеаниматология и интенсивная терапияРевматологияРепродукция и генетикаСексологияСомнологияСпортивная медицинаСтоматологияСурдологияТерапияТравматология и ортопедияТрансфузиологияТрихологияУЗИУльтразвуковая диагностикаУрология и андрологияФармакологияФизиотерапияФлебологияЧелюстно-лицевая хирургияЭндокринологияЗатрудняюсь выбрать (будет выбрана терапия)

Кому адресован вопросВопрос адресован: ВсемКонсультантам

Консультант, которому задается вопрос: Всем…Агабекян Нонна Вачагановна (Акушер, Гинеколог)Айзикович Борис Леонидович (Педиатр)Акмалов Эдуард Альбертович (Аллерголог, Врач спортивной медицины)Александров Павел Андреевич (Венеролог, Гепатолог, Инфекционист, Паразитолог, Эпидемиолог)Александрова Анна Михайловна (Педагог, Психолог, Психотерапевт)Али Мохамед Гамал Эльдин Мансур (Педиатр)Аристова Анастасия Михайловна (Андролог, Уролог, Хирург)Армашов Вадим Петрович (Хирург)Афанасьева Дарья Львовна (Кардиолог, Терапевт)Беляева Елена Александровна (Гинеколог, Невролог, Рефлексотерапевт)Бушаева Ольга Владимировна (Пульмонолог, Терапевт)Врублевская Елена (Педиатр)Гензе Ольга Владимировна (Генетик, Педиатр)Горохова Юлия Игоревна (Венеролог, Врач общей практики, Дерматолог)Григорьева Алла Сергеевна (Врач общей практики, Терапевт)Демидова Елена Леонидовна (Психолог, Психотерапевт)Денищук Иван Сергеевич (Андролог, Уролог)Дибиров Магомед Гусейнович (Стоматолог)Димина Тамара Олеговна (Акушер, Аллерголог, Ангиохирург)Довгаль Анастасия Юрьевна (Маммолог, Онколог, Радиолог)Долгова Юлия Владимировна (Педиатр)Дьяконова Мария Алексеевна (Гериатр, Терапевт)Жердакова Дарья Владимировна (Акушер, Гинеколог)Загумённая Анна Юрьевна (Врач спортивной медицины, Гирудотерапевт, Диетолог, Косметолог, Терапевт)Зверев Валентин Сергеевич (Ортопед, Травматолог)Згоба Марьяна Игоревна (Окулист (Офтальмолог))Зинченко Вадим Васильевич (Рентгенолог, Хирург)Зорий Евген Владимирович (Невролог, Психолог, Терапевт, Хирург)Извозчикова Нина Владиславовна (Гастроэнтеролог, Дерматолог, Иммунолог, Инфекционист, Пульмонолог)Илона Игоревна (Врач общей практики, Гастроэнтеролог, Терапевт, Эндокринолог)Калявина Светлана Николаевна (Акушер, Гинеколог)Калягина Екатерина (Другая специальность)Карпенко Алик Викторович (Ортопед, Травматолог)Касимов Анар Физули оглы (Онколог, Хирург)Киреев Сергей Александрович (Психиатр, Психолог, Психотерапевт)Кирнос Марина Станиславовна (Стоматолог, Стоматолог детский, Стоматолог-терапевт)Копежанова Гульсум (Акушер, Гинеколог)Кравцов Александр Васильевич (Нарколог, Психиатр)Красильников Андрей Викторович (Врач ультразвуковой диагностики, Медицинский директор, Флеболог, Хирург)Кряжевских Инна Петровна (Терапевт, Гастроэнтеролог)Кудряшова Светлана Петровна (Эндокринолог)Куртанидзе Ираклий Малхазович (Окулист (Офтальмолог))Кущ Елена Владимировна (Диетолог, Терапевт)Лазарева Татьяна Сергеевна (ЛОР (Оториноларинголог))Лаптева Лариса Ивановна (Невролог)Лебединская Татьяна Александровна (Психолог, Психотерапевт)Ледник Максим Леонидович (Венеролог, Дерматолог)Леонова Наталья Николаевна (Детский хирург)Литвиненко Станислав Григорьевич (Ортопед, Травматолог)Лямина Ирина Алексеевна (Акушер)Максименко Татьяна Константиновна (Инфекционист)МАЛЬКОВ РОМАН ЕВГЕНЬЕВИЧ (Диетолог, Остеопат, Реабилитолог)Мамедов Рамис (ЛОР (Оториноларинголог))Мартиросян Яков Ашотович (Детский хирург, Проктолог, Травматолог, Уролог, Хирург)Маряшина Юлия Александровна (Акушер, Венеролог, Врач ультразвуковой диагностики, Гинеколог, Педиатр)Матвеева Ярослава Дмитриевна (Педиатр)Мершед Хасан Имадович (Вертебролог, Нейрохирург)Миллер Ирина Васильевна (Невролог)Мильдзихова АЛЬБИНА Бексолтановна (Врач общей практики, Гинеколог, ЛОР (Оториноларинголог), Педиатр, Терапевт)Муратова Наталья Сергеевна (Врач общей практики, Диетолог)Мухорин Виктор Павлович (Нефролог)Наумов Алексей Алексеевич (Мануальный терапевт)Никитина Анна Алексеевна (Окулист (Офтальмолог))Ольга Викторовна (Невролог, Неонатолог, Педиатр, Реабилитолог, Терапевт)Павлова Мария Игоревна (Стоматолог, Стоматолог-хирург, Челюстно-лицевой хирург)Панигрибко Сергей Леонидович (Венеролог, Дерматолог, Косметолог, Массажист, Миколог)Пантелеева Кристина Алексеевна (Невролог)Пастель Владимир Борисович (Ортопед, Ревматолог, Травматолог, Хирург)Паунок Анатолий Анатольевич (Андролог, Уролог)Першина Наталия Сергеевна (Невролог)Прокофьева Анастасия Михайловна (ЛОР (Оториноларинголог))Прохоров Иван Алексеевич (Нейрохирург, Хирург)Пушкарев Александр Вольдемарович (Гинеколог, Психотерапевт, Реабилитолог, Репродуктолог (ЭКО), Эндокринолог)Пьянцева Екатерина Вячеславна (Педиатр)Радевич Игорь Тадеушевич (Андролог, Венеролог, Сексолог, Уролог)Сапрыкина Ольга Александровна (Невролог)Свечникова Анастасия Евгеньевна (Стоматолог, Стоматолог детский, Стоматолог-ортопед, Стоматолог-терапевт, Стоматолог-хирург)Семений Александр Тимофеевич (Врач общей практики, Реабилитолог, Терапевт)Сергейчик Никита Сергеевич (Анестезиолог, Гомеопат)Силуянова Валерия Викторовна (Акушер, Врач ультразвуковой диагностики, Гинеколог)Соболь Андрей Аркадьевич (Кардиолог, Нарколог, Невролог, Психиатр, Психотерапевт)Сошникова Наталия Владимировна (Эндокринолог)Степанова Татьяна Владимировна (ЛОР (Оториноларинголог))Степашкина Анастасия Сергеевна (Гематолог, Пульмонолог, Терапевт)Сурова Лидия (Гирудотерапевт, Невролог, Терапевт)Суханова Оксана Александровна (Клинический фармаколог, Психолог)Сухих Данил Витальевич (Психиатр)Тумарец Кирилл Михайлович (Врач лечебной физкультуры, Врач спортивной медицины, Кинезитерапевт, Реабилитолог, Физиотерапевт)Турлыбекова Венера Равильевна (Врач общей практики, Педиатр)Устимова Вера Николаевна (Гематолог, Терапевт, Трансфузиолог)Фатеева Анастасия Александровна (Гастроэнтеролог, Диетолог, Психотерапевт, Эндокринолог)Федотова Татьяна Владимировна (Врач ультразвуковой диагностики, Гематолог, Терапевт)Фоминов Олег Эдуардович (Сексолог)Фоминов Олег Эдуардович (Сексолог)Фурманова Елена Александровна (Аллерголог, Иммунолог, Инфекционист, Педиатр)Хасанов Эльзар Халитович (Андролог, Врач ультразвуковой диагностики, Онколог, Уролог, Хирург)Хасанова Гульнара Сунагатулловна (Акушер, Врач ультразвуковой диагностики)Чупанова Аида (Акушер, Гинеколог)Чупанова Аида Идаятовна (Акушер, Гинеколог, Репродуктолог (ЭКО))Швайликова Инна Евненьевна (Окулист (Офтальмолог))Шибанова Мария Александровна (Нефролог, Терапевт)Щепетова Ольга Александровна (Терапевт)Ягудин Денар Лукманович (ЛОР (Оториноларинголог))Ярвела Марианна Юрьевна (Психолог)

Описание проблемы:

Пол: —укажите пол—ЖенщинаМужчина

Возраст:

Характеристика гемолизинов штаммов Staphylococcus, выделенных от человека и крупного рогатого скота, южный Иран

Iran J Vet Res. 2014 Осень; 15 (4): 326–330.

Z Moraveji

1 Студент DVM, Школа ветеринарной медицины, Ширазский университет, Шираз, Иран;

M Tabatabaei

2 Кафедра патобиологии, Школа ветеринарной медицины и Институт биотехнологии, Ширазский университет, Шираз, Иран;

H Ширзад Аски

3 Тел.D. Студент бактериологии, отделение патобиологии, Школа ветеринарной медицины, Ширазский университет, Шираз, Иран;

R Khoshbakht

4 Окончил Школу ветеринарной медицины, Ширазский университет, Шираз, Иран

1 Студент DVM, Школа ветеринарной медицины, Ширазский университет, Шираз, Иран;

2 Кафедра патобиологии, Школа ветеринарной медицины и Институт биотехнологии, Ширазский университет, Шираз, Иран;

3 Тел.D. Студент бактериологии, отделение патобиологии, Школа ветеринарной медицины, Ширазский университет, Шираз, Иран;

4 Окончил Школу ветеринарной медицины Ширазского университета, Шираз, Иран

* Переписка: М. Табатабаи, кафедра патобиологии, Школа ветеринарной медицины, Ширазский университет, Шираз, Иран. E-mail: [email protected]

Поступило 5 ноября 2013 г .; Пересмотрено 20 мая 2014 г .; Принято 18 июня 2014 г.

Эта статья цитировалась в других статьях в PMC.

Abstract

Стафилококки — важные патогенные бактерии, вызывающие различные инфекции у животных и человека. Гемолизин является одним из факторов вирулентности коагулазо-положительных (CPS) и коагулазонегативных стафилококков (ЦНС). Целью исследования было охарактеризовать гемолизины Staphylococcus spp. выделено фенотипически и генотипически от человека и крупного рогатого скота. Фенотипическая характеристика гемолизина на основе картины гемолиза Staphylococcus spp.проводили на чашках с агаром с кровью овцы, лошади и кролика. Гены, кодирующие гемолизин, амплифицировали со специфическими праймерами с использованием метода полимеразной цепной реакции (ПЦР). Гемолитическая активность фенотипически определялась у 60 и 90% всех изолятов крупного рогатого скота и человека, соответственно. Все негемолитические изоляты относились к ЦНС (P≤0,05). Во всех изолятах гены hla и hld определяли с помощью ПЦР-амплификации. Ни один из изолятов крупного рогатого скота и человека не показал фенотипически и генотипически гамма-гемолизин.Результаты этого исследования позволяют предположить, что, в соответствии с общепринятым мнением, очевидны некоторые различия в типах гемолизина среди штаммов Staphylococcus бычьего и человеческого происхождения. Кроме того, это исследование показало, что ЦНС может играть важную роль в качестве новых патогенов.

Ключевые слова: Staphylococcus spp., Гемолизин, изоляты человека и крупного рогатого скота, ПЦР

Введение

Стафилококки хорошо известны как бактериальные патогены, вызывающие множественные типы инфекций как у человека, так и у животных (Le Loir et al., 2003 ▶; Salasia et al., 2004 ▶). В диагностике инфекций стафилококки делятся на коагулазо-положительные (CPS) и коагулазонегативные стафилококки (ЦНС) в зависимости от способности коагулировать кроличью плазму. Как правило, Staphylococcus aureus является коагулазо-положительным, хотя коагулазо-отрицательные изоляты S. aureus действительно встречаются (Fox et al., 1996). Хотя S. aureus считается патогеном, наиболее часто выделяется ЦНС, особенно от гнойных инфекций у человека и субклинического мастита у коров, овец и коз (Le Loir et al., 2003 ▶; Саласия и др., 2004 ▶; да Силва и др., 2005 ▶). Некоторые виды этого рода, в частности, S. aureus , вызывают множество заболеваний, продуцируя ряд ферментов и токсинов, вторгаясь в хозяйские клетки, такие как гемолизины (da Silva et al., 2005 ▶). В настоящее время гемолизины стафилококков подразделяются на четыре различных типа, включая альфа (α), бета (β), гамма (γ) и дельта (δ) (Aarestrup et al., 1999 ▶). Альфа-токсин представляет собой порообразующий гептамер экзотоксин, который лизирует в основном эритроциты кролика, но токсичен для эпителиальных клеток человека (Gouaux et al., 1994 ▶). Бета-гемолизин представляет собой сфингомиелиназу, которая очень активна в отношении эритроцитов овец и крупного рогатого скота (Larsen et al., 2002). Бета-токсин также известен как горячо-холодный токсин из-за его уникальной активности на пластинах с агаром с овечьей кровью. При 37 ° C бета-токсин взаимодействует с эритроцитами барана, но не лизирует их. Если затем поместить эритроциты при 4 ° C, клетки лизируются; это наблюдается как отсутствие гемолиза на чашках с кровяным агаром при 37 ° C, а затем полный гемолиз при 4 ° C (Huseby et al., 2007).Гамма-токсин представляет собой двухкомпонентный экзотоксин, включающий по крайней мере шесть различных комбинаций белков, одним из которых является лейкоцидин, который влияет на эритроциты лошади (Dinges et al., 2000). Дельта-токсин — это низкомолекулярный экзотоксин, который образует мультимерные структуры со способностью лизировать многие типы клеток (Novick et al., 2003 ▶). Несколько исследований показали, что гемолизины S. aureus хорошо коррелируют с инфекциями у человека и животных (Tackeuchi et al., 2001; Larsen et al., 2002 ▶). Однако имеется скудная информация о производстве гемолизинов в ЦНС, изолированном от мастита животных и инфекций человека, особенно в Иране. Генотипические различия между S. aureus , выделенными от человека и крупного рогатого скота, наблюдались многими авторами (Zadoks et al., 2000; Reinoso et al., 2004). Одной из ключевых характеристик, используемых для различения линий человека и крупного рогатого скота, является гемолитический паттерн. Таким образом, сообщалось, что большинство бычьих изолятов CPS продуцируют бета-гемолизин и являются продуцентами переменного альфа-гемолизина, тогда как большинство изолятов CPS человека продуцируют альфа-гемолизин, но только ограниченное количество изолятов продуцирует бета-гемолизин (Hummel et al., 1992 ▶; Aarestrup et al., 1999 ▶). На сегодняшний день имеется мало информации о гемолитической картине ЦНС. Итак, цель нашего настоящего исследования состояла в том, чтобы определить и сравнить распространенность гемолитических стафилококков, выделенных от крупного рогатого скота и человека, как фенотипическими, так и генотипическими методами.

Кроме того, мы продемонстрировали гемолитическую способность ЦНС, изолированной от мастита животных и инфекций человека в Ширазе, на юге Ирана.

Материалы и методы

Бактериальные изоляты

Всего 40 Staphylococcus spp.изолированы от инфекций человека (n = 20) и мастита коров (n = 20), а также 9 эталонных штаммов (IROST) Staphylococcus spp. были использованы в настоящем исследовании. Образцы Staphylococcus spp. были получены от кожных инфекций пациентов в больнице Намази и маститного молока 20 дойных коров с 15 ферм, расположенных в Ширазе на юге Ирана. Во-первых, различные изоляты были идентифицированы как CPS и CNS на основе окрашивания по Граму, теста на коагулазу и каталазу, восстановления теллурита, активности лецитиназы и ферментации маннита на агаре с маннитоловой солью (MSA).Кроме того, изоляты идентифицировали с помощью родовой ПЦР-амплификации гена 16S рРНК (данные не показаны).

Характеристика гемолизинов

Типы гемолизинов были охарактеризованы на основе зоны лизиса каждого стафилококкового изолята на трехкратных чашках с основанием кровяного агара с добавлением 5% крови овцы, лошади и кролика после 24 и 48 ч инкубации при 37 ° C. Для удаления любых возможных антигемолизиновых соединений, присутствующих в сыворотке, эритроциты промывали стерильным физиологическим раствором и ресуспендировали в физиологическом растворе до исходного объема крови (Ebrahimi et al., 2009 ▶). Гены, кодирующие гемолизины Staphylococcus spp. были выполнены путем амплификации генов hla , hlb , hld и hlg для альфа-, бета-, дельта- и гамма-гемолизина с использованием метода ПЦР, соответственно. Программы ПЦР и последовательности праймеров перечислены в.

Таблица 1

Нуклеотидные последовательности, используемые в качестве праймеров для обнаружения генов гемолизина

(° C) Подготовка ДНК и анализ ПЦР

Бактериальную геномную ДНК экстрагировали из ночных культур изолятов с использованием процедуры, описанной ранее (Ahmadi et al., 2010 ▶). Чистоту и концентрацию ДНК оценивали спектрофотометрически при 260 и 280 нм. После гена 16S рРНК была проведена ПЦР для идентификации Staphylococcus spp. И для обнаружения генов гемолизина, перечисленных в для каждого подтвержденного изолята. Амплификацию бактериальной ДНК проводили в общем реакционном объеме 25 мкл, который содержал 2 мкл ДНК-матрицы из чистых культур. Реакционная смесь состояла из 2,5 мкл 10-кратного буфера для ПЦР (75 мМ Трис-HCl, pH = 9,0, 2 мМ MgCl 2 , 50 мМ KCl, 20 мМ [NH 4 ] 2 SO 4 ), (CinnaGen, Иран), 1 мкл dNTP (50 мкМ), (CinnaGen), 1 мкл (1 ед. ДНК-полимеразы Ampli Taq), (CinnaGen), 1 мкл (25 пмоль) от прямого и обратного праймеров (CinnaGen), показаны в, а объемы реакционных смесей достигали 25 мкл с использованием дистиллированной деионизованной воды.Матричную ДНК первоначально денатурировали при 94 ° C в течение 7 мин. Затем было проведено 35 циклов амплификации в программируемом термоциклере (MJ mini, BioRad, США). Каждый цикл состоял из денатурации в течение 1 мин при 94 ° C, отжига праймера в течение 1 мин при 58 ° C и удлинения в течение 1 мин при 72 ° C. За последним циклом следовало окончательное удлинение при 72 ° C в течение 7 минут, а затем продукты ПЦР оставались в термоциклере при 4 ° C до тех пор, пока они не были собраны. Отрицательный контроль, содержащий воду, был включен в каждый эксперимент.Продукты ПЦР разделяли электрофорезом в электрофорезе в 1,5% агарозном геле и визуализировали окрашиванием бромидом этидия и УФ-трансиллюминацией (BTS-20, Япония). Лэддер ДНК длиной 100 п.н. (CinnaGen, Иран) использовали в качестве маркера размера молекулы ().

Электрофорез в агарозном геле продуктов ПЦР генов гемолизина Staphylococcus spp. Дорожка M: маркер ДНК 100 п.н. (CinnaGen, Иран). Дорожка 1: отрицательный образец, дорожка 2: гл. (209 п.н.), полоса 3: гл.н. (309 п.н.), полоса 4: гл. (111 п.н.)

Статистический анализ

Для статистического анализа был проведен критерий хи-квадрат для анализа ассоциации генов гемолизина в образцах человека и крупного рогатого скота.Значение p ≤0,05 считалось статистически значимым.

Результаты

По результатам культуральных и биохимических свойств, наряду с амплификацией 16S рРНК, все изоляты, исследованные в настоящем исследовании, были идентифицированы как Staphylococcus . Всего 5 и 8 из 20 изолятов крупного рогатого скота и человека были CPS соответственно. Фенотипическая активность гемолизина была обнаружена у 60 и 90% всех изолятов крупного рогатого скота и человека. Наличие негемолитических изолятов значительно различается среди ЦНС и CPS, и все негемолитические изоляты относятся к ЦНС (P≤0.05). На чашках с агаром с овечьей кровью большая часть Staphylococcus , выделенного от крупного рогатого скота, показала дельта-гемолизин, в то время как большинство человеческих изолятов продуцировало альфа-гемолизин. Из 20 человеческих изолятов 10 (50%) продуцировали двойной гемолизин (DH), но бычьи изоляты показали значительно низкое соотношение DH (1 из 20) (P≤0,05). Путем ПЦР-амплификации гена, кодирующего гемолизин Staphylococcus spp. со специфическими праймерами можно было наблюдать, что гены hla и hld присутствовали во всех изолятах.Кроме того, в комбинации с hla и hld ген hlb был обнаружен в 3 (15%) из 20 изолятов стафилококка , собранных от крупного рогатого скота, 8 (40%) из 20 изолятов, собранных из люди, которые значительно различались (P≤0,05), и 4 (44,4%) из 9 эталонных штаммов. Ни один из изолятов человека и крупного рогатого скота не показал фенотипически и генотипически гамма-гемолизин. Распределение различных генов гемолизина среди Staphylococcus spp.исследуемое в настоящем исследовании показано в.

Таблица 2

Характеристика гемолизинов штаммов Staphylococcus

Название праймера Последовательность (от 5 до 3΄) Целевой ген Температура отжига Размер продукта
(bp)
Каталожный номер
HLA-1 CTGATTACTATCCAAGAAATTCGATTG гл. 58 209 Жарро и др. ., 2002
HLA-2 CTTTCCAGCCTACTTTTTTATCAGT
HLB-1 GTG14ATAGTACTGC глб 58 309 Джарро и др. , 2002
HLB-2 GTTGATGAGTAGCTACCTTCAGT hld 58 111 Жарро и др. ., 2002
HLD-2 TTAGTGAATTTGTTCACTGTGTCGA
mpHLG-1 GTCAYGAGCATCC гл. 58 535 Жарро и др. , 2002
mpHLG-2 CACCAAATGTATAGCCTAAAGTG
BA NC 9014 9014 NC 9014 9014 NC NC δ 9014 9014 человек 90 145 NC 9014
Штаммы Коагулазный тест Фенотипическая характеристика
S. saprophyticus PTCC 1440 NC NC NC α, δ
С.xylosus PTCC 1444 NC NC β α, β, δ
S. simulans PTCC 1442 δ δ β α, β, δ
S. chromogenes PTCC 1433 NC NC NC α, δ
S. Intermedius PTCC 1438 + α α β α, β, δ
С.haemolyticus PTCC 1437 α α α α, δ
S. epidermidis PTCC 1436 α α β α, β, δ
S. sciuri PTCC 1441 δ δ δ α, δ
S. aureus PTCC 1764 + NC α α α, δ
Бычий 1 NC NC NC NC Bovine 2 NC NC NC α, δ
Bovine 3 δ δ δ3144 B + NC α β α, β, δ
Bovine 5 δ δ δ α, δ12 Bovine NC NC NC α, δ
Bovine 7 δ δ δ α, δ Bov 9014 5 δ δ α, δ
Бычий 9 δ δ δ α, δ
Бычий 10 α, δ
Корова 11 δ δ δ α, δ
Бык 12 + DH α , β, δ
Бычий 13 NC NC NC α, δ
Бычий 14 NC NC NC NC NC NC NC NC
КРС 15 + NC α β α, β, δ
Корова 16 δ δ13
Бычий 17 + NC δ δ α, δ
Бычий 18 + δ δ δ 9014 9014 9014 9014 9014 9014 9014 9014 9014 9014 9014 9014 901 — NC NC NC α, δ
Bovine 20 NC NC NC α, δ 9014 9014 9014 человек α DH α, β, δ
Человек 2 + NC α DH α, δ
Человек 3 α DH α, β, δ
Человек 4 + NC α DH α, β, δ
Человек 5 δ α, δ
Человек 6 NC α α α, δ
Человек 7 NC α α , δ
Человек 8 NC α DH α, δ
Человек 9 NC NC NC NC NC NC NC NC
Человека 10 NC α α α, δ
Человека 11 δ δ δ3 α, Человека α, человека δ δ δ α, δ
Человек 13 + NC α DH α, δ
α DH α, β, δ
Человек 15 δ δ δ α, β, δ
Человек 16 NC α α α, β, δ
Человек 17 NC NC NC α, δ
9014 9014 9014 человек 18 δ δ α, δ
Человек 19 + NC α DH α, β, δ
Человек 20 NC α DH α, β, δ

Обсуждение

Стафилококки — бактерии, наиболее часто выделяемые при мастите крупного рогатого скота и инфекциях человека.Заболевания, вызываемые этим родом, являются результатом синтеза нескольких факторов вирулентности, включая различные гемолизины, которые важны для вирулентности S. aureus и других стафилококков (da Silva et al., 2005 ▶). На сегодняшний день роль ЦНС как причины мастита крупного рогатого скота и инфекций человека и их гемолизиновых факторов не совсем ясна. Итак, в этом исследовании мы исследовали фенотипическое и генотипическое распределение четырех гемолизинов в изолятах ЦНС и CPS крупного рогатого скота и человека.В этом исследовании, в дополнение к образцам CPS (5 и 8 изолятов крупного рогатого скота и человека), были использованы 15 и 12 образцов ЦНС, выделенных от инфекций крупного рогатого скота и человека. Мы обнаружили относительно большие различия в распространенности гемолизинов в изолятах Staphylococcus человека и крупного рогатого скота. Все изолированные CPS демонстрировали гемолитическую активность либо по отдельности, либо в комбинированных формах, в то время как 25% штаммов ЦНС не были гемолитическими. Аналогичное исследование маститного козьего молока в бразильских молочных стадах показало высокие уровни отдельных или комбинированных типов гемолизина, продуцируемых S.aureus и ЦНС (да Силва и др., 2005). Подобные результаты были описаны Watts and Owens (1987), которые наблюдали продукцию гемолизина S. xylosus и S. sciuri . Фенотипически большинство изолятов крупного рогатого скота демонстрировали дельта-гемолиз на овечьем, конском и кроличьем кровяном агаре, в то время как человеческие изоляты производили альфа-гемолиз, который, согласно многим исследованиям, показал различия между гемолизинами, продуцируемыми S. aureus , выделенными из мастита крупного рогатого скота, и из человеческие инфекции (Сильва и Кардосо, 2000; Ларсен и др., 2002 ▶). Тодар в 2005 г. предположил, что большая часть изолятов S. aureus , выделенных у человека, обычно имеет бета-гемолитический характер, поскольку тромбоциты и моноциты человека более чувствительны к альфа-токсину, а большинство изолятов человека S. aureus не экспрессируют ß-токсин. Известно, что лизогенный бактериофаг кодирует токсин. CPS, выделенные от животных, в основном продуцируют охарактеризованный бета-токсин из-за чувствительности эритроцитов животных к этому токсину, но в этом исследовании большинство изолятов ЦНС крупного рогатого скота продуцировали дельта-гемолизин, что могло быть связано с различиями в продукции гемотоксина у штаммов крупного рогатого скота с ЦНС и CPS.Кроме того, в этом исследовании двойной гемолизин, наблюдаемый в изолятах человека, был значительно выше, чем в изолятах крупного рогатого скота (P≤0,05). Возможно, это может указывать на то, что человеческие штаммы более патогенны, однако для подтверждения этой гипотезы необходимы дальнейшие исследования. Как показано на фиг.4, все из 49 штаммов CNS, CPS и эталонных штаммов, протестированных с помощью ПЦР, были положительными по генам альфа- и дельта-гемолизина. Эти показатели соответствуют данным других авторов (Silva and Cardoso, 2000; Ларсен и др., 2002 ▶; Ebrahimi et al., 2009 ▶). Кроме того, в комбинации с альфа и дельта бета-гемолизин наблюдался в 40% человеческих штаммов, что значительно выше, чем у бычьих изолятов (P≤0,05), что также подтверждает гипотезу о большей патогенности человеческих штаммов. В настоящем исследовании у всех изолятов отсутствовала экспрессия гамма-гемолизина. Генотипы гемолизина ЦНС и CPS в этом исследовании, по-видимому, не коррелировали с выражением их фенотипов. На него могут влиять многие факторы на уровне генетических или фенотипических.

Наличие генов hla и hld в S. aureus и ЦНС важно для этих изолятов, связанных со случаями стафилококковой инфекции, вызвавшей заболевание животных и человека (Ariyanti et al., 2011 ▶). Это исследование продемонстрировало, что гены hla и hld широко распространены среди S. aureus и ЦНС, выделенных от крупного рогатого скота и человека. Кроме того, результаты этого исследования позволяют предположить, что, в соответствии с общепринятым мнением, очевидны некоторые различия в типах гемолизина среди штаммов Staphylococcus бычьего и человеческого происхождения.Кроме того, это исследование показало, что ЦНС вырабатывает гемотоксины, и это может быть важным в качестве нового патогена.

Благодарности

Эта работа была поддержана Школой ветеринарной медицины Ширазского университета, Иран. Кроме того, авторы хотят поблагодарить участников исследования за их вклад в исследование, а также нынешних и прошлых исследователей и сотрудников. Авторы выражают особую благодарность A. Shahed за лабораторную помощь.

Ссылки

  • Aarestrup, FM, Larsen, HD, Eriksen, NH, Elsberg, CS, Jensen, NE.Частота альфа- и бета-гемолизина в золотистом стафилококке крупного рогатого скота и человека. Сравнение фенотипа и генотипа и вариации фенотипического выражения. . APMIS. 1999; 107: 425–430. [PubMed] [Google Scholar]
  • Ахмади, М., Рохани, С.М.Р., Айремлоу, Н. Обнаружение Staphylococcus aureus в молоке с помощью ПЦР. Комп. Clin. Патол. 2010; 19: 91–94. [Google Scholar]
  • Ariyanti, D, Salasia, SIO, Tato, S. Характеристика гемолизина Staphylococcus aureus, выделенного из пищевых продуктов животного происхождения.Индонезийский J. biotech. 2011; 16: 32–37. [Google Scholar]
  • Да Силва, ER, Boechat, JUD, Martins, JCD, Ferreira, WPB, Siqueira, AP, da Silva, N. Производство гемолизина видами Staphylococcus aureus, выделенными из маститного козьего молока в бразильских молочных стадах. Маленький ром. Res. 2005; 56: 271–275. [Google Scholar]
  • Динджес, М.М., Орвин, П.М., Шливерт, П.М. Экзотоксины золотистого стафилококка. Clin. Microbiol. Ред. 2000; 13: 16–34. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Ebrahimi, A, Akhavan, TM.Характеристики стафилококков, выделенных от коров с клиническим и субклиническим маститом в Шахрекорде, Иран. Иранский J. Vet. Res. 2009. 10: 273–277. [Google Scholar]
  • Fox, LK, Besser, TE, Jackson, SM. Оценка коагулазонегативного варианта Staphylococcus aureus как причины интрамаммарных инфекций в стаде молочного скота. Варенье. Вет. Med. Доц. 1996; 209: 1143–1146. [PubMed] [Google Scholar]
  • Gouaux, JE, Braha, O, Hobaugh, MR, Song, L, Cheley, S, Shustak, C, Bayley, H.Субъединичная стехиометрия стафилококкового альфа-гемолизина в кристаллах и на мембранах: гептамерная трансмембранная пора. Proc. Natl. Акад. Sci. США. 1994; 91: 12828–12831. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Hummel, R, Devriese, LA, Lehmann, G. Характеристики бычьего Staphylococcus aureus с особым учетом активности фактора слипания. Int. J. Med. Microbiol. Virol. Паразитол. Заразить. Дис. 1992; 276: 487–492. [PubMed] [Google Scholar]
  • Huseby, M, Shi, K, Brown, CK, Digre, J, Mengistu, F, Seo, KS, Bohach, GA, Schlievert, PM, Ohlendorf, DH, Earhart, CA.Структура и биологическая активность бета-токсина Staphylococcus aureus. J. Bacteriol. 2007. 189: 8719–8726. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Jarraud, S, Mougel, C, Thioulouse, J, Lina, G, Meugnier, H, Forey, F, Nesme, X, Etienne, J, Vandenesch, F. Связь между генетическим фоном Staphylococcus aureus, факторами вирулентности, агрогруппами (аллелями) и заболеваниями человека. Заразить. Иммун. 2002; 70: 631–641. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Larsen, HD, Aarestrup, FM, Jensen, NE.Географические различия в наличии генов, кодирующих суперантигенные экзотоксины и бета-гемолизин, среди Staphylococcus aureus, выделенных от мастита крупного рогатого скота в Европе и США. Вет. Microbiol. 2002. 85: 61–67. [PubMed] [Google Scholar]
  • Le Loir, Y, Baron, F, Gautier, M. Staphylococcus aureus и пищевое отравление. Genet. Мол. Res. 2003; 2: 63–76. [PubMed] [Google Scholar]
  • Новик, Р.П. Аутоиндукция и передача сигнала в регуляции вирулентности стафилококков. Мол. Microbiol.2003. 48: 1429–1449. [PubMed] [Google Scholar]
  • Reinoso, E, Bettera, S, Frigerio, C, DiRenzo, M, Calzolari, A, Bogni, C. Анализ RAPD-ПЦР штаммов Staphylococcus aureus, выделенных от крупного рогатого скота и человека-хозяев. Microbiol. Res. 2004. 159: 245–255. [PubMed] [Google Scholar]
  • Salasia, SIO, Khusnan, Z, Lämmler, C, Zschöck, M. Сравнительные исследования фено- и генотипических свойств Staphylococcus aureus, выделенного от крупного рогатого скота с субклиническим маститом в Центральной Яве в Индонезии и Гессене в Германия.J. Vet. Sci. 2004. 5: 103–109. [PubMed] [Google Scholar]
  • Silva, Nda, Cardoso, HFT. Производство гемолитических токсинов изолятами золотистого стафилококка от мастита крупного рогатого скота. Вет. Notícias. 2000. 6: 63–67. [Google Scholar]
  • Tackeuchi, S, Maeda, T, Hashimoto, N, Imaizumi, K, Kaidoh, T., Hayakawa, Y. Вариация локуса agr в изолятах Staphylococcusaureus от коров с маститом. Вет. Microbiol. 2001. 79: 267–274. [PubMed] [Google Scholar]
  • Тодар, К. Тодар, онлайн-учебник по бактериологии.Стафилококк. Отделение бактериологии, Университет Винкосин-Мэдисон; 2055. www.textbookofbacteriology.net/staph.html. [Google Scholar]
  • Watts, JL, Owens, WE. Синергетический гемолиз, связанный с коагулазонегативными стафилококками, выделенными из молочных желез крупного рогатого скота. J. Clin. Microbiol. 1987; 25: 2037–2039. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Zadoks, R, van Leeuwen, W., Barkema, H, Sampimon, O, Verbrugh, H, Schukken, Y, van Belkum, A. Применение геля с импульсным полем электрофорез и бинарное типирование как инструменты ветеринарной клинической микробиологии и молекулярно-эпидемиологического анализа изолятов золотистого стафилококка крупного рогатого скота и человека.J. Clin. Microbiol. 2000; 38: 1931–1939. [Бесплатная статья PMC] [PubMed] [Google Scholar]

22A: Идентификация видов стафилококка

Объективы

  • Ознакомьтесь с видообразованием рода Staphylococcus .
  • Выращивайте и идентифицируйте различные виды стафилококков с использованием селективного и дифференциального агара
  • Идентифицируйте 3 гемолитических типа на кровяном агаре.

Staphylococcus — это род Gram +, неспорообразующих кокков, принадлежащих к семейству Micrococcaceae , которые часто встречаются как нормальная микробиота кожи и носовой полости человека.В этом роде есть пять организмов, которые следует рассматривать в качестве потенциальных патогенов человека: S. aureus , S. epidermidis , S. saprophiticus , S. haemolyticus и S. .. hominis , но первые три изолятов являются наиболее распространенными. S.aureus часто считается наиболее проблематичным из трех патогенов и отличается от двух других тем, что является единственным, способным коагулировать плазму. S. aureusis может вызывать многие поверхностные гнойные (гнойные) инфекции дермы и подлежащих тканей, а также серьезные системные инфекции. Он может производить ряд токсинов, включая энтеротоксины (пищевое отравление), цитотоксины (общие системные токсины) и суперантигены токсического шока. Другие коагулазонегативные стафилококки ( S. epidermidis и S. saprophiticus ) гораздо реже обнаруживаются в качестве патогенов, но иногда связаны с эндокардитом, инфекциями протезных суставов и раневыми инфекциями. назвать несколько.

Это упражнение дает вам возможность использовать селективную среду , в данном случае основанную на высоком содержании хлорида натрия (MSA и SM1 10 являются селективными средами для выделения Staphylococci — 7,5% NaCl). Селективная среда содержит ингибитор, который способствует росту одних бактерий, подавляя другие. MSA содержит дополнительный индикатор для мониторинга ферментации маннита, что делает его также дифференциальной средой . Из бактерий, которые могут расти в присутствии высокого содержания NaCl, некоторые являются галофильными (для роста требуют определенной концентрации соли), а другие — галодурическими (соль не используется, но они могут ее переносить). Staphylococcusis не галофильный, а скорее галодурический, в том смысле, что он может жить или переносить высокие концентрации NaCl. Высокое содержание соли в SM1 10 и MSA подавляет другие распространенные кожные микроорганизмы. Другие среды, используемые в этом упражнении, предназначены для дифференциации патогенного стафилококка от непатогенного и для идентификации вида.

Не только солеустойчивый, Стафилококк всегда факультативно анаэробен.При окрашивании он будет виден небольшими скоплениями (стафило = скопление). Стафилококк обычно является либо бета-гемолитическим, либо совсем не гемолитическим (так называемый гамма-гемолиз). Патогенные Стафилококки могут продуцировать различные факторы вирулентности, включая токсины, коагулазу, лейкоцидины и гидролитические ферменты, которые могут повреждать ткани хозяина.

Кровяной агар (БАП) состоит из 5% овечьей крови. Это обычная среда, используемая для культивирования бактерий, потому что:

  1. Это отличная среда для обогащения привередливых бактерий.
  2. Гемолиз клеток крови может быть очень полезным в качестве идентификационного теста.

CNA-агар — это кровяной агар. Единственная разница в том, что CNA содержит антибиотик , наладиксиновую кислоту , который подавляет грамотрицательные бактерии.

Гемолиз — это распад красных кровяных телец. Гемолизины — это ферменты, вырабатываемые некоторыми бактериями и выделяемые в среду вокруг бактериальной колонии. Это может быть полный распад клеток с высвобождением гемоглобина и очисткой от красного цвета окружающей среды вокруг колонии.Или гемолиз может быть частичным, в результате чего вокруг колонии образуется зеленоватая или желто-зеленая зона.

НЕОБХОДИМЫЕ МАТЕРИАЛЫ: по таблице

  • Стерильные тампоны
  • Стерильный физиологический раствор
  • 1 чашки с маннитоловым солевым агаром (MSA)
  • Емкости со спиртом + пинцет
  • 1 пластина с колумбийским агаром с наладиксиновой кислотой
  • 1 Стафилококковая среда 110 (SM110) агаровая пластина
  • 1 пластина с ДНКазным агаром
  • Новобиоцин (5 микрограмм) диски с антибиотиком
  • Метрические линейки
  • Плазма кролика (замороженная) для теста на коагулазу
  • Другие среды для идентификации:
      и
    • аргинин бульоны декарбоксилазы
    • бульон мочевины
    • ONPG
    • сахароза, трегалоза, мальтоза
    • VP-бульон
    • нитратный бульон
    • тиогликолятный бульон (для анаэробного роста)

СХЕМА ПРОЦЕДУРЫ ИДЕНТИФИКАЦИИ

1 -й сеанс  ⇒ 2 -й сеанс  ⇒ 3 -й сеанс  ⇒ 4 -й сеанс

CNA DNAse Coagulase Выполнить другие необходимые тесты SM110 ONPG

Каталаза оксидаза

Грамм Феноловая красная лактоза

Пятновой бульон

ПРОЦЕДУРЫ

Примечание

Обязательно сохраните список из всех результатов тестов для ваших изолятов.

1

st Сессия
  1. На каждом столе будет указан вид стафилококков, растущих на чашках с АНА или TSA.
  2. Используя технику выделения , инокулируйте колумбийскую наладиксиновую кислоту (CNA) и поместите диск с новобиоцином в секцию 1.
  3. Чувствительность к новобиоцину является ключевой отличительной чертой среди некоторых видов Staphylococcus . Поместите щипцы в спирт и затем простерилизуйте щипцы, быстро пропуская их через пламя.Спирт загорится, и когда он испарится из щипцов, они станут стерильными. Теперь вы можете взять диск с новобиоцином из держателя и разместить его на планшете CNA — в секции FIRST штриховок (где будет сливаться рост бактерии).
  4. Для других чашек с агаром — чашки SM 110, чашки с агаром с маннитоловой солью (MSA), чашки с агаром с ДНКазой — линия посева по центру чашки подходит для результатов роста.
  5. Инкубируйте среду при 37 ° C.
  6. Проведите тесты на оксидазу и каталазу на культуре на чашках.
  7. Окрашивают изолят по Граму для придания формы и расположения, а также реакции по Граму.
  8. В следующем сеансе мы будем проводить тестирование ONPG. Этот тест требует включения набора генов, lac-оперона. Чтобы вызвать эту активность, бактерия должна контактировать с лактозой. Вот почему вы также сделаете прививку в пробирку с бульоном из фенолового красного лактозы.

2

nd Сессия
  1. Перейдите к индивидуальным лабораторным упражнениям, чтобы интерпретировать тест на соль маннита и ДНКазу (требуется HCl).
  2. На пластине CNA вы проверяете 2 реакции — чувствительность к новобиоциновому антибиотику И гемолиз крови.
    1. Чувствительность к новобиоцину — зона 17 мм указывает на чувствительность
    2. Гемолитические реакции:
      • альфа (α) гемолиз — зеленая зона вокруг колонии, вызванная утечкой гемоглобина, преобразованного в биливердин, называемая частичным гемолизом
      • бета (β) гемолиз– полная очистка вокруг колонии, вызванная разрушением эритроцитов ферментами стрептолизина
      • гамма (γ) гемолиз — без гемолизинов, без зоны
        • Staphylococcus являются либо бета-гемолитическими, либо гамма-(не гемолитическими) видами. Staph aureus продуцирует альфа-токсин, который обычно вызывает широкие зоны бета (полного) гемолиза.
  3. Проверьте SM 110 на рост и пигмент. Питательные вещества и витамины в этой среде усиливают пигментацию патогенного стафилококка , при этом эти колонии становятся желто-оранжевыми колониями.
  4. Запустите тест на коагулазу: для этого теста есть связанное упражнение. Есть только несколько видов Staphylococcus , которые положительны для теста на коагулазу (см. Таблицу ниже), и S.aureus является наиболее распространенным. Поскольку существует 2 типа фермента коагулазы — связанный и свободный — для идентификации этих ферментов можно использовать 2 различных теста. Метод TUBE — это окончательный тест из двух, самый надежный. Эти две версии четко описаны в упражнении по тесту на коагулазу в руководстве по лаборатории.
  5. Будет запущен тест ONPG . Поищите в лабораторных упражнениях этот тест, чтобы узнать, как его проводить. Поскольку жидкости в пробирке очень мало, вам нужно прикрыть верх пробирки парафильмом, а затем надеть на нее верхнюю часть пробирки.Это уменьшает обезвоживание.

3

rd Сессия
  1. Основная тестовая реакция для использования в идентификации Staphylococcus — это реакция на коагулазный тест, которая делит род Staphylococcus на 2 группы — коагулазо-отрицательные виды и коагулазоположительные виды. Тестовый носитель, который вы будете запускать для идентификации, зависит от того, к какой категории относится ваш организм. Возможно, вы захотите провести некоторые из следующих тестов.
  • Доступные среды :
    • аргинин и орнитин
    • бульоны декарбоксилазы
    • бульон мочевины
    • ONPG
    • сахароза, трегалоза, мальтозные сахара
    • 10 VP109 бульон
    • 0
    1. Если у вас есть коагулазоположительный стафилококк Staph , на ваш выбор доступно только несколько видов: таблица с этими видами приведена ниже.
    2. Если ваши микроорганизмы не содержат коагулазы , проверьте приведенную ниже блок-схему, а также Руководство Берджи или другие справочники по идентификации.
    3. Выполните необходимые тесты для идентификации. ВЫ ОПРЕДЕЛЯЕТЕ, КАКИЕ ДОПОЛНИТЕЛЬНЫЕ ИСПЫТАНИЯ ВЫПОЛНЯТЬ ДЛЯ ЧЕТКОЙ ИДЕНТИФИКАЦИИ.

    4

    Сессия
    1. Прочтите все тесты из последнего сеанса (информацию об интерпретации тестов см. В лабораторных упражнениях.
    2. Напишите отчет для определения вида вашего Staphylococcus , если ваш инструктор попросит вас сделать это
    G GS.aureus 9150 9150 S.
    Таблица 1: Дифференциация среди коагулазоположительных стафилококков
    Пробирка коагулазы Кислота из трегалозы 9063 VP test + + +
    S. Intermedius + + +
    переменная +
    S. schleiferi + + ?

    Общие коагулазо-отрицательные Стафилококковые виды

    большинство штаммов) 506
    Таблица 2: Дифференциация S.aureus из других распространенных стафилококков человека нормальная флора
    S. aureus S. epidermidis S. saprophiticus
    Альфа-токсин большинство штаммов)
    Рост на 7,5% соли (соль маннита)
    Кислота из маннита +
    Коагулазная реакция +
    Производство пигментов (SM110) Обычно золотистые Обычно белые 6 Обычно белые + (обычно)
    Чувствительность к новобиоцину чувствительна чувствительна устойчива

    * Чувствительность к новобиоцину => размер зоны 17 мм

    ВОПРОСЫ

      Какой тип гемолиза часто ассоциируется с гемолизом?
    1. Каковы отличительные признаки стафилококков рода ?
    2. Можете дать тестовую реакцию S.aureus для каждого из основных тестов — MSA, SM110, коагулазы, каталазы, оксидазы и ДНКазы?
    3. Что происходит с эритроцитами при бета- и альфа-гемолизе?

    Авторы и авторство

    Продукция β-токсина Staphylococcus aureus является обычным явлением в штаммах с геном β-токсина, инактивированным бактериофагом | Журнал инфекционных болезней

    Аннотация

    Фон. Staphylococcus aureus вызывает опасные для жизни инфекции, включая инфекционный эндокардит, сепсис и пневмонию.β-токсин представляет собой сфингомиелиназу, кодируемую практически всеми штаммами S. aureus и проявляющую цитотоксичность для иммунных клеток человека. Токсин усиливает фенолорастворимый модулин S. aureus , а его активность усиливается суперантигенами. Бактериофаг φSa3 встраивается в ген β-токсина в человеческих штаммах, инактивируя его в большинстве клональных групп S. aureus . Следовательно, сообщается, что большинство штаммов не секретируют β-токсин.

    Методы. Эта динамика была исследована путем изучения продукции β-токсина множеством клональных групп S.aureus как in vitro, так и in vivo во время инфекций на кроличьих моделях инфекционного эндокардита, сепсиса и пневмонии.

    Результаты. Фенотипические варианты β-токсина распространены среди штаммов, содержащих φSa3. In vivo, φSa3 по-разному индуцируется в вегетации сердца, абсцессах почек и ишемической печени по сравнению с селезенкой и кровью, а также в росте in vitro в жидкой культуре. Кроме того, при пневмонии продукция β-токсина дикого типа приводит к развитию крупных казеозных поражений, а при инфекционном эндокардите увеличивает размер патогномоничных вегетаций.

    Выводы. Это исследование демонстрирует динамическое взаимодействие между S. aureus и инфицированным хозяином, где φSa3 служит регулятором экспрессии гена вирулентности, а также повышенной приспособляемости и вирулентности в новых условиях.

    Золотистый стафилококк колонизирует кожу и слизистые оболочки человека. Часто считается оппортунистическим, но это очень успешный патоген. В 2007 году Центры по контролю и профилактике заболеваний сообщили, что S.aureus — основная причина серьезных инфекционных заболеваний в США [1]. S. aureus вызывает пневмонию, инфекционный эндокардит, сепсис и многие другие распространенные инфекции [2–7]. Способность S. aureus вызывать заболевания зависит от клеточной поверхности и секретируемых факторов вирулентности, обеспечивающих выживание в кровотоке, прилипание тканей и уклонение от иммунитета.

    Цитолизины и суперантигены имеют решающее значение. S. aureus секретирует факторов вирулентности [5, 8].α-, β-, γ- и δ-токсины продуцируются штаммом S. aureus и проявляют большую токсичность для клеток-хозяев, включая иммунные клетки [8, 9]. β-токсин исторически известен как «горячий-холодный» гемолизин и сфингомиелиназа (SMase) [10, 11]. β-токсин токсичен для моноцитов человека [12], полиморфно-ядерных лейкоцитов [13], кератиноцитов [14] и лимфоцитов [13, 15, 16]. Даже если активность β-токсина SMase не вызывает прямого лизиса клеток, она оставляет клетки уязвимыми для других токсинов, таких как фенолрастворимые модуляны (PSM) [17, 18].

    Вклад β-токсина в болезни человека остается неясным. Эпидемиологические исследования показывают, что β-токсин способствует рецидиву фурункулеза S. aureus , хронического остеомиелита и респираторных инфекций у людей [19, 20], а также развитию глазного кератита [21] и мастита [22] у животных. . Кроме того, β-токсин связывает ДНК, образуя нуклеопротеидный комплекс ковалентно сшитых молекул. Эта активность, называемая лигазой биопленок, не зависит от активности SMase и способствует образованию биопленок в растениях, которые являются патогномоничными для инфекционного эндокардита [23].Действие β-токсина в отдельности и в синергизме с другими цитолизинами S. aureus [17, 18] и суперантигенами [16] может способствовать развитию патологии, связанной с инфекциями.

    Сообщается, что большинство изолятов S. aureus человека, за исключением изолятов из клональной группы CC30 / ST36 / USA200, не экспрессируют β-токсин из-за интеграции бактериофага φSa3 в структурный ген β-токсина hlb [24, 25]. φSa3 кодирует дополнительные гены вирулентности, которые, как сообщается, участвуют в уклонении от иммунитета, включая суперантигены, стафилокиназу (SAK), белок, ингибирующий хемотаксис (CHIP), и ингибитор стафилококкового комплемента (SCIN) [26–29].Учитывая специфичность этих дополнительных генных продуктов для клеток человека и высокую частоту встречаемости φSa3 среди изолятов человека по сравнению с животными [30], общепринято считать, что факторы вирулентности, кодируемые фагом φSa3, обеспечивают большее преимущество перед S. aureus для человека. колонизация и выживание, чем производство β-токсина.

    Недавние данные показывают, что инактивация β-токсина φSa3 не является неопределенной [31]. Штаммы S. aureus , полученные от пациентов с муковисцидозом (МВ) или бактериемией, демонстрируют признаки удаления фага по сравнению с изолятами из ноздрей здоровых людей [32, 33]. Изоляты S. aureus от пациентов с МВ и бактериемией составляют гетерогенную популяцию фаг-положительных и отрицательных, а в некоторых изолятах МВ фаг вырезается и перемещается в атипичные участки хромосомы [33]. Удаление фага с образованием β-токсина было также зарегистрировано в S. aureus , выращенном в культуре с ципрофлоксацином и триметопримом, антибиотиками, используемыми для лечения пациентов с МВ [34]. Эти наблюдения предполагают, что во время хронических инфекций давление хозяина и / или лечение антибиотиками способствует удалению фага с последующим продуцированием β-токсина, что, возможно, приносит пользу S.aureus выживаемость и прогрессирование болезни.

    Связанный с сообществом метициллин-устойчивый штамм MW2 S. aureus (CA-MRSA) (клональная группа USA400) был выделен у ребенка, умершего от стафилококковой пневмонии и синдрома токсического шока (СТШ) [35, 36]. S. aureus MW2 является исключительной причиной пневмонии, инфекционного эндокардита и сепсиса у кроликов [37, 38]. MW2 несет φSa3 и, следовательно, считается, что не производит β-токсин. Однако во время наших исследований инфекционного эндокардита мы наблюдали продуцирующие β-токсин колонии MW2, выделенные из вегетации кроликов [39].Производство β-токсина также наблюдали in vitro, когда MW2 наносили сильными штрихами на чашки с агаром с овечьей кровью (SBAP) из замороженных запасов. Основываясь на этих наблюдениях, мы исследовали, было ли удаление фага обычным явлением в клональных группах S. aureus , содержащих φSa3, и рассмотрели эту динамику как in vitro, так и in vivo на кроличьих моделях инфекции.

    МАТЕРИАЛЫ И МЕТОДЫ

    Условия роста и частота подсчетов

    CA-MRSA MW2 был утилизирован из низкопроходных запасов.MW2 hyper-β был выделен из исходного исходного материала MW2 дикого типа посредством трех циклов пассажа при 37 ° C на SBAP с отбором изолятов с одной колонией, продуцирующих зоны β-токсина. Ночные культуры MW2 выращивали при 30 ° C, 37 ° C и 42 ° C при встряхивании 220 оборотов в минуту в бульоне Тодда-Хьюитта (TH; Difco Laboratories, Детройт, штат Мичиган) или говяжьего сердца (BH) [40], разбавляли и высевали на SBAP при вышеупомянутых температурах для подсчета частоты колоний, продуцирующих β-токсин. Подсчет частоты определяли путем идентификации колоний, продуцирующих β-токсин, на SBAP: (1) отдельные колонии с внутренними зонами гемолиза + большие темные внешние зоны с результирующим горячим-холодным гемолизом или (2) дискретные, сильно литические пятна при более низких разведениях, затем делят на общее количество колониеобразующих единиц (КОЕ).Колонии β-токсина + были аналогичным образом идентифицированы из гомогенизированных тканей кролика: крови, инфаркта селезенки, ишемической печени, абсцессов почек и геморрагических / некротических легких после пневмонии и вегетации аорты кроликов с инфекционным эндокардитом и сепсисом. Бактериальные разведения наносили на SBAP и инкубировали при 37 ° C.

    Анализ ингибирования лизиса эритроцитов овцы

    Предметные стекла микроскопа были покрыты 4 мл 1% агарозы (Sigma Aldrich, St.Louis, MO), содержащий эритроциты барана. Кровь овец промывали центрифугированием (400 × г , 10 минут) 3 раза с фосфатно-солевым буфером (PBS; 0,005 M NaPO 4 , 0,15 M NaCl) и 50 мкл упакованных клеток добавляли к 10 мл раствора. 1% агарозы, чтобы покрыть предметные стекла микроскопа и дать затвердеть. Для анализов лунки диаметром 4 мм пробивали в агарозе и заполняли 20 мкл PBS, гипериммунной антисывороткой к β-токсину, гипериммунной антисывороткой к α-токсину или антисывороткой к β-токсину + антисывороткой к α-токсину.Планшеты инкубировали при 37 ° C до тех пор, пока PBS или сыворотка не абсорбировались агарозой. Супернатанты от ночных культур S. aureus обрабатывали 4 объемами абсолютного этанола для осаждения β-токсина, токсин из каждого образца ресуспендировали в воде до 1/10 его исходной концентрации, и 20 мкл концентратов помещали в сосуд. колодцы. Срезы инкубировали в течение ночи при 37 ° C, а затем инкубировали 4 часа при 4 ° C. Диаметр лизиса измеряли и анализировали с помощью программы ImageJ Национального института здоровья [41].

    Обнаружение генов

    Непрерывный hlb был обнаружен с помощью полимеразной цепной реакции (ПЦР) с набором праймеров β-токсином.F (5′-ATGGTGAAAAAAACAAAATCCAA-3 ‘) и β-токсином.2R (5′-CCCAATCAAAGCCTATAGTAAATAG-3’). Обнаружение фагов проводили с помощью наборов праймеров int -F (5′-CTGCTGGACTAGACAAGTTAAATGAG-3 ‘) и int -R (5′-GAGTGTGTCTTAATGCGTGCG-3′), специфичных для гена интегразы, и Scn-1 / Scn2, специфичных для SCIN (описан ранее [30]).

    Модель пневмонии и инфекционного эндокардита / сепсиса на кроликах

    новозеландских белых кроликов анестезировали кетамином (25 мг / кг) и ксилазином (25 мг / кг) (Phoenix Pharmaceuticals, Burlingame, CA).Модель пневмонии была выполнена, как описано ранее [37]. Кроликам вводили 1 × 10 9 бактерий (в объемах 0,3 мл) посредством интратрахеальной инокуляции. Эксперименты продолжались до 7 дней. Модель инфекционного эндокардита / сепсиса была выполнена, как описано ранее [39]. Вкратце, твердые пластиковые катетеры вводили через левую сонную артерию, оставляли на 2 часа, удаляли и разрез закрывали. Через краевую вену уха вводили 1-2 × 10 7 бактерий.Эксперименты продолжались до 4 суток. Во время смерти или эвтаназии сердечные вегетации вскрывали, взвешивали, гомогенизировали и помещали на чашки для определения частоты колоний β-токсина + и бактериальных КОЕ на все вегетации в пределах одного сердца. КОЕ также определяли по венозной крови. Эксперименты на животных проводили в соответствии с руководящими принципами и протоколом, утвержденным Комитетом по институциональному уходу и использованию животных Университета Айовы (протокол 1106140).

    Статистический анализ

    Статистическая значимость в экспериментах по выживанию определялась с использованием лог-ранга, критерия Мантела – Кокса, а значимость по средним значениям — с помощью теста Манна – Уитни (программное обеспечение GraphPad Prism).

    РЕЗУЛЬТАТЫ

    S. aureus MW2 и LAC продуцируют варианты β-токсина во время роста in vitro 5′-конец β-токсин-превращающих фагов является консервативным, включая интегразу и сайт прикрепления [30]. φSa3 кодирует факторы вирулентности на обоих концах. Стафилококковый энтеротоксин, такой как (SE -1 ) -K и SE -1 -Q, кодируется на 5′-конце; SEA, SAK и SCIN кодируются на 3′-конце (рис. 1 A ). Иссечение фага восстанавливает неповрежденный hlb и приводит к продукции β-токсина.CA-MRSA MW2, выращенный в течение ночи в жидкой культуре и посеянный на SBAP с высокой плотностью, привел к появлению гиперлитических пятен после инкубации в течение ночи при 37 ° C (рис. 1 B ). Повторное разделение колоний с гиперлитических пятен дает изолированные колонии либо с узкой зоной гемолиза, либо с узкой зоной гемолиза + большой внешней темной зоной (рис. 1 C ). После инкубации в течение ночи при 4 ° C клетки крови во внешних темных зонах лизировались, что свидетельствует о продукции β-токсина. Также были отмечены колонии с эллиптической зоной гемолиза, что свидетельствует о низком уровне удаления фага и секреции β-токсина в растущих колониях (рис. 1 C , левая панель).MW2 дикого типа и вариант, продуцирующий β-токсин (излеченный фагом), названный MW2 (гипер-β), сравнивали с тестом Christie Atkins Munch-Petersen (CAMP) на синергизм с PSM. В тесте CAMP MW2 дикого типа продуцирует чистую зону гемолиза только в той области, где PSM MW2 встречаются с β-токсином, продуцируемым контрольным штаммом RN4220, вертикальными штрихами поперек планшета. Тонкая и диффузная зона гемолиза наблюдается вокруг полосы MW2 дикого типа (рис. 1 D , левая панель), что указывает на низкий уровень или отсутствие продукции β-токсина.Однако вокруг гипер-β MW2 полностью наблюдается четкая гемолитическая зона, что указывает на продукцию β-токсина (рис. 1 D , правая панель).

    Рисунок 1.

    Вырезание фага φSa3 восстанавливает продукцию β-токсина. A , Схема кодирования φSa3 факторов вирулентности, включая SE -1 -K, SE -1 -Q, SEA, SAK и SCIN. B , Гиперлитические пластыри, полученные из S. aureus MW2, нанесенные на SBAP с высокой плотностью. C , изоляты MW2, продуцирующие различные уровни β-токсина (на левой панели показаны изоляты с узкой зоной или эллиптической зоной гемолиза, а на правой панели показаны изоляты с яркой зоной гемолиза, окруженной большой темной зоной из-за β-токсина. ). D , CAMP-тест, сравнивающий синергизм гипер-β-токсина MW2 дикого типа и MW2 с PSM.

    Сокращения: CAMP, Кристи Аткинс Мунк-Петерсен; ПСМ, фенолрастворимые модуляны; SBAP, чашки с агаром с овечьей кровью.

    Рисунок 1.

    Вырезание фага φSa3 восстанавливает продукцию β-токсина. A , Схема кодирования φSa3 факторов вирулентности, включая SE -1 -K, SE -1 -Q, SEA, SAK и SCIN. B , Гиперлитические пластыри производства S.aureus MW2, нанесенный на SBAP с высокой плотностью. C , изоляты MW2, продуцирующие различные уровни β-токсина (на левой панели показаны изоляты с узкой зоной или эллиптической зоной гемолиза, а на правой панели показаны изоляты с яркой зоной гемолиза, окруженной большой темной зоной из-за β-токсина. ). D , CAMP-тест, сравнивающий синергизм гипер-β-токсина MW2 дикого типа и MW2 с PSM.

    Сокращения: CAMP, Кристи Аткинс Мунк-Петерсен; ПСМ, фенолрастворимые модуляны; SBAP, чашки с агаром с овечьей кровью.

    Четыре дополнительных клинических изолята S. aureus USA400 выращивали в жидкой культуре и высевали на SBAP, чтобы определить, присутствуют ли варианты, продуцирующие β-токсин. Гиперлитические пятна наблюдались у всех 4 штаммов в разном количестве (дополнительные данные A ). Мы оценили штамм USA300 LAC (штамм Фитцджеральда), также с ранее инактивированным геном α-токсина ( гл, ), на гемолиз β-токсина при посеве на SBAP; гиперлитические пятна трудно наблюдать в присутствии высоких уровней α-токсина, продуцируемого LAC.В этом штамме также наблюдались литические пятна (дополнительные данные, левая панель). Извлечение вариантов, продуцирующих β-токсин, также возможно из штамма LAC дикого типа (дополнительные данные, правая панель). Поскольку стало очевидно, что варианты, продуцирующие β-токсин, присутствуют в штаммах различных клональных линий, мы проверили и обнаружили присутствие интактного гена β-токсина во многих клональных группах США (рис. 2). Хотя ген β-токсина остается неизменным во многих клональных группах, фаг остается преобладающим среди штаммов.ПЦР-скрининг генов интегразы и scn обнаружил присутствие фага в 42 из 44 протестированных изолятов (данные не показаны). Эти результаты показывают, что, хотя φSa3 широко распространен, варианты, продуцирующие β-токсин, присутствуют среди изолятов S. aureus нескольких линий.

    Рисунок 2.

    Структурный ген интактного β-токсина присутствует среди различных клональных групп S. aureus . ПЦР-скрининг полноразмерного гена β-токсина в клональных группах USA100–400 и нетипируемых штаммах.Аббревиатура: ПЦР, полимеразная цепная реакция.

    Рисунок 2.

    Структурный ген интактного β-токсина присутствует среди различных клональных групп S. aureus . ПЦР-скрининг полноразмерного гена β-токсина в клональных группах USA100–400 и нетипируемых штаммах. Аббревиатура: ПЦР, полимеразная цепная реакция.

    β-токсин производится на различных уровнях в США 100 – США 400 штаммов

    Мы провели тест CAMP на нескольких изолятах из клональных групп USA100 – USA400, чтобы проверить продукцию β-токсина.Четкая зона гемолиза вокруг полоски указывает на продукцию β-токсина. Лизис наблюдали у нескольких штаммов из всех клональных групп (дополнительные данные A D ). Однако форма стрелки между поперечными полосами указывает на выработку α-токсина, что затрудняет выводы относительно продукции β-токсина. Точно так же зоны неполного гемолиза в отсутствие четкого лизиса указывают на продукцию α- и β-токсина, поскольку активность β-токсина противодействует активности α-токсина [42].Поэтому мы протестировали концентраты культуральных супернатантов на литическую активность на слайдах агарозы клеток крови барана в присутствии или в отсутствие β-токсин-специфической сыворотки. Сыворотка против β-токсина ингибировала гемолиз в штамме MW2 hyper-β (8-кратное уменьшение зоны лизиса), демонстрируя, что гемолиз происходит из-за β-токсина (рис. 3 A ). β-токсин был также обнаружен в MW2 дикого типа, штаммах USA200, MN8 и CDC587, и в очень низких уровнях в штаммах USA400 IA96 и PSGN (фиг. 3 B ). Модель S.aureus лабораторный штамм RN4220 (который секретирует β-токсин в больших количествах) предоставил доказательства специфичности сыворотки β-токсина и роли β-токсина в гемолитической зоне, которая возникает после обработки концентратами культуральных супернатантов (рис. А
    ).

    Рисунок 3.

    Количественная оценка продукции β-токсина с помощью анализов ингибирования гемолиза антител. A , анализы ингибирования гемолиза штаммов MW2 (гипер-β), MN8 и MW2 дикого типа, демонстрирующие гемолиз концентратов культуры по сравнению с гемолизом культуры, ингибируемым сывороткой против β-токсина. B , Площадь лизиса, измеренная в см по результатам анализов ингибирования гемолиза штаммов USA200 и USA400; черная полоса представляет собой область лизиса концентратов культур. Серая полоса представляет собой область лизиса при ингибировании сывороткой против β-токсина.

    Рисунок 3.

    Количественная оценка продукции β-токсина с помощью анализов ингибирования гемолиза антител. A , анализы ингибирования гемолиза штаммов MW2 (гипер-β), MN8 и MW2 дикого типа, демонстрирующие гемолиз концентратов культуры по сравнению с гемолизом культуры, ингибируемым сывороткой против β-токсина. B , Площадь лизиса, измеренная в см по результатам анализов ингибирования гемолиза штаммов USA200 и USA400; черная полоса представляет собой область лизиса концентратов культур. Серая полоса представляет собой область лизиса при ингибировании сывороткой против β-токсина.

    Рисунок 4.

    Анализы ингибирования гемолиза штаммов USA100 и USA300. A , Изображение анализа ингибирования гемолиза S. aureus RN4220 культурального концентрата отдельно, с сывороткой против β-токсина, с сывороткой против α-токсина или с сывороткой как против β-, так и α-токсина для демонстрации гемолиза за счет каждого токсина; площади лизиса, измеренные в сантиметрах по результатам анализа ингибирования гемолиза ( B ) S.aureus RN4220, штаммы USA100 и ( C ) USA300. Черная полоса представляет область лизиса из концентратов культур, темно-серая полоса представляет область лизиса при ингибировании сывороткой против β-токсина, серая полоса представляет область лизиса при ингибировании сывороткой против α-токсина, а светло-серая полоса представляет область лизиса, когда ингибируется как анти-β, так и анти-α сывороткой.

    Рисунок 4.

    Анализы ингибирования гемолиза штаммов USA100 и USA300. A , Изображение анализа ингибирования гемолиза S.концентрат культуры aureus RN4220 отдельно, с сывороткой против β-токсина, с сывороткой против α-токсина или с сывороткой как против β-, так и против α-токсина, чтобы продемонстрировать гемолиз из-за каждого токсина; площади лизиса, измеренные в сантиметрах с помощью анализов ингибирования гемолиза штаммов ( B ) S. aureus RN4220, USA100 и ( C ) USA300. Черная полоса представляет область лизиса из концентратов культур, темно-серая полоса представляет область лизиса при ингибировании сывороткой против β-токсина, серая полоса представляет область лизиса при ингибировании сывороткой против α-токсина, а светло-серая полоса представляет область лизиса, когда ингибируется как анти-β, так и анти-α сывороткой.

    Штаммы в клональных группах USA100 и USA300 продуцируют высокие уровни α-токсина, некоторые из которых остаются активными в концентратах супернатантов. Следовательно, для этих штаммов лунки обрабатывали либо сывороткой против α-токсина отдельно, либо в сочетании с сывороткой против β-токсина. Штаммы USA100 IA209 и IA116 образовывали зоны гемолиза; однако лизис концентратов IA209 происходил в значительной степени за счет β-токсина, а лизис из IA116 в значительной степени за счет α-токсина (рис. 4 B ). Штаммы USA300 LAC и IA1012 продуцировали β-токсин на низких уровнях (фиг. 4 C ).Кроме того, мы проверили частоту вариантов продуцирования β-токсина в выбранных изолятах USA100–300. В жидкой культуре частота колоний β-токсина варьировалась от 1 / 2000–1 / 20 (USA100), 1 / 500–1 / 31 (USA200) и 1 / 380–1 / 260 (USA300) (дополнительные данные E ). ).

    Производство β-токсина в MW2 усугубляет патологию пневмонии

    Штаммы

    USA200 считаются преобладающей клональной группой, связанной с продукцией β-токсина. Эти штаммы могут вызывать S. aureus пневмонию и летальность, где летальность возникает в результате системных эффектов токсина-1 СТШ и развития СТШ [43].Вклад β-токсина в пневмонию S. aureus не определен. Первоначальные исследования предполагают, что токсин способствует повреждению легких [44]. MW2 был возбудителем пневмонии и СТШ у ребенка со Среднего Запада [36]. Поскольку MW2 hyper-β продуцирует в 4-8 раз больше β-токсина в жидкой культуре, чем родительский штамм, мы оценили, коррелирует ли повышенный уровень β-токсина с повышенным повреждением легких и обострением пневмонии на модели кролика.

    Бактерии были инокулированы интратрахеально, и инфекция продолжалась в течение ≤7 дней.В этих экспериментальных условиях 1 кролик, инфицированный штаммом дикого типа, погиб от инфекции в день 1, в то время как все остальные инфицированные кролики (дикого типа и гипер-β) выжили. В легких кроликов, инфицированных диким типом MW2, были обнаружены классические признаки пневмонии S. aureus , включая геморрагический плевральный выпот, диффузное или геморрагическое уплотнение и казеозные гранулемы (рис. 5 A ). Поразительно, что повышенная экспрессия β-токсина штаммом MW2 (гипер-β) приводит к образованию более крупных казеозных гранулем.В легких животных, инфицированных штаммом MW2 (гипер-β), также наблюдалась тяжелая геморрагическая консолидация и плевральный выпот (рис. 5 B ). Эти результаты свидетельствуют о том, что β-токсин способствует патологии легких.

    Рисунок 5.

    MW2 и MW2 (гипер-β) на кроличьей модели пневмонии. Легкие иссекали у кроликов, инфицированных ( A ) MW2 дикого типа или ( B ) MW2 (гипер-β). Пунктирными линиями выделены области гранулем.

    Рисунок 5.

    MW2 и MW2 (гипер-β) на кроличьей модели пневмонии.Легкие иссекали у кроликов, инфицированных ( A ) MW2 дикого типа или ( B ) MW2 (гипер-β). Пунктирными линиями выделены области гранулем.

    Производство β-токсина способствует развитию вегетации у кроликов, вызывающих инфекционный эндокардит / сепсис Модель

    β-токсин обладает лигазной активностью биопленок, индуцируя образование ковалентных нуклеопротеидных комплексов [23], помогающих образовывать биопленки. β-токсин способствует формированию вегетации под действием MRSA COL на кроличьей модели инфекционного эндокардита [23].Тогда можно было бы ожидать, что повышенные уровни продукции β-токсина могут привести к увеличению образования биопленок на сердечных клапанах, что приведет к увеличению размеров вегетации.

    Чтобы проверить это, кроликов инфицировали MW2 дикого типа и гипер-β вариантом в течение ≤4 дней. Используемая доза была выбрана потому, что она дает сходные кривые выживаемости между штаммами, гарантируя, что размер растительности не зависит от разницы во времени выживания (рис. 6 A ) [39]. Количество бактерий, выделенных из крови инфицированных животных, существенно не различалось между штаммами, что указывает на то, что образование растительности не было связано с различиями в выживаемости бактериального кровотока (фиг. 6 B ).У всех зараженных кроликов развилась вегетация. Растения у кроликов, инфицированных MW2 дикого типа, составляли в среднем 25 мг, в то время как вегетации у кроликов, инфицированных MW2 hyper-β, составляли в среднем 80 мг (рис. 6 C ). Подобные КОЕ были извлечены из растительности (Рисунок 6 D ).

    Рисунок 6.

    MW2 и MW2 (гипер-β) на кроличьей модели инфекционного эндокардита и сепсиса. A , Процент выживаемости кроликов из групп, инфицированных MW2 и MW2 (гипер-β), каждый день после заражения до завершения эксперимента на 4 день. B , КОЕ / мл, выделенных из крови на момент смерти для каждой экспериментальной группы. C , Средняя масса вегетации в миллиграммах, полученная из сердечных клапанов каждой экспериментальной группы. D , Среднее общее количество КОЕ, восстановленных на растительность в каждой экспериментальной группе.

    Сокращение: КОЕ, колониеобразующие единицы.

    Рисунок 6.

    MW2 и MW2 (гипер-β) на кроличьей модели инфекционного эндокардита и сепсиса. A , Процент выживаемости кроликов из групп, инфицированных MW2 и MW2 (гипер-β), каждый день после заражения до завершения эксперимента на 4 день. B , КОЕ / мл, выделенных из крови на момент смерти для каждой экспериментальной группы. C , Средняя масса вегетации в миллиграммах, полученная из сердечных клапанов каждой экспериментальной группы. D , Среднее общее количество КОЕ, восстановленных на растительность в каждой экспериментальной группе.

    Сокращение: КОЕ, колониеобразующие единицы.

    β-токсин

    + Увеличение частоты колоний при инфекционном эндокардите на растениях, печени и почках Мы проверили, изменилась ли частота вариантов, продуцирующих β-токсин, в результате воздействия окружающей среды или давления хозяина на популяцию бактерий.MW2 культивировали в течение ночи в бульонах TH и BH при 30 ° C, 37 ° C и 42 ° C и высевали на SBAP. При 30 ° C, субоптимальной температуре для роста S. aureus , варианты, продуцирующие β-токсин, составляли в среднем 1/500 всех колоний в обоих бульонах (фиг. 7 A ). При 37 ° C (температура тела) и 42 ° C (высокая температура) частота колоний β-токсинов увеличивалась с 1/500 до 1/200 при выращивании в бульоне TH и с 1/200 до 1/100 при выращивании в BH. бульон. Частота колоний β-токсина также значительно увеличилась в бульоне BH с 1/500 при 30 ° C до 1/200 при 37 ° C.

    Рисунок 7.

    Частота образования β-гемолитических колоний зависит от экологической ниши. A , Отношение β-гемолитических колоний к общему количеству колоний из культур, выращенных в средах TH или BH при 30 ° C, 37 ° C или 42 ° C и высеянных на чашки с агаром с овечьей кровью; B , Отношение β-гемолитических колоний к общему количеству выделенных колоний из тканей кроликов, использованных в модели инфекционного эндокардита и сепсиса, при инокулировании S. aureus MW2. * P ≤ 0.05, ** P ≤ 0,009, *** P ≤ 0,0009. Звездочки на панели A сравнивают средние различия при 30 ° C, 37 ° C и 42 ° C в средах TH или BH. Звездочки на панели B сравнивают средние различия крови по сравнению с растениями, печенью или почками.

    Сокращения: BH, говяжье сердце; TH, Тодд-Хьюитт.

    Рисунок 7.

    Частота образования β-гемолитических колоний в зависимости от экологической ниши. A , Отношение β-гемолитических колоний к общему количеству колоний из культур, выращенных в средах TH или BH при 30 ° C, 37 ° C или 42 ° C и высеянных на чашки с агаром с овечьей кровью; B , Отношение β-гемолитических колоний к общему количеству выделенных колоний из тканей кроликов, использованных в модели инфекционного эндокардита и сепсиса при инокулировании S.aureus МВт2. * P ≤ 0,05, ** P ≤ 0,009, *** P ≤ 0,0009. Звездочки на панели A сравнивают средние различия при 30 ° C, 37 ° C и 42 ° C в средах TH или BH. Звездочки на панели B сравнивают средние различия крови по сравнению с растениями, печенью или почками.

    Сокращения: BH, говяжье сердце; TH, Тодд-Хьюитт.

    Зная, что прививка MW2 на кроличьей модели инфекционного эндокардита / сепсиса приводит как к образованию вегетации, так и к метастатическим абсцессам и ишемии тканей, мы проверили, как рост в различных тканях влияет на частоту колоний β-токсинов.Кролики были инфицированы MW2 после механического повреждения клапанов аорты [39], и бактерии были протестированы непосредственно на продукцию β-токсина из растений, абсцессов почек, ишемической печени, геморрагических легких, инфаркта селезенки и крови (Рисунок 7 B ) . Частота колоний β-токсина в крови и селезенке напоминала частоты после выращивания в бульоне BH при 37 ° C (1/200) и 42 ° C (1/100), соответственно (Рисунок 7). Колонии, восстановленные из растений и ишемической печени, имели самую высокую частоту (1/30), затем следовали абсцессы почек (1/40) и геморрагические легкие (1/80) (рис. 7 B ).Эти результаты демонстрируют динамическую природу фага φSa3, позволяющую продуцировать β-токсин в подмножестве бактериальных популяций при различных давлениях окружающей среды и хозяина.

    ОБСУЖДЕНИЕ

    β-токсин кодируется в большинстве штаммов S. aureus независимо от происхождения хозяина. Однако фаг, инактивирующий ген β-токсина, φSa3, широко распространен среди штаммов человеческого происхождения [25, 26]. Продукция β-токсина считается характеристикой штаммов S. aureus , принадлежащих только к линии USA200, обычных колонизаторов слизистых оболочек [45, 46].φSa3 присутствует в 77–93% изолятов S. aureus в определенных коллекциях штаммов [30, 47, 48]. Эти исследования предполагают, что большинство штаммов S. aureus человека не продуцируют β-токсин, и, следовательно, токсин не играет никакой роли в патогенезе S. aureus .

    Мы показываем, что штаммы, несущие φSa3, существуют как гетерогенные популяции, содержащие субпопуляцию, продуцирующую β-токсин. Интактные гены β-токсинов были амплифицированы с хромосом штаммов клональных групп USA100 – USA400 и нетипируемых штаммов.Варианты, продуцирующие β-токсин, были непосредственно обнаружены в этих штаммах, что было определено по наличию гиперлитических пятен на SBAP и гемолизу β-токсина, обнаруженному на слайдах эритроцитов барана. Удаление фага, приводящее к продукции β-токсина, зависело от условий культивирования. In vitro рост MW2 в бульоне BH при 42 ° C вызывал наибольшую частоту колоний, продуцирующих β-токсин (1/100), тогда как рост при 37 ° C в бульоне TH приводил к частоте 1/500. Поскольку рост при 42 ° C в бульоне BH может больше напоминать окружающую среду человека во время заражения лихорадкой, мы непосредственно рассмотрели, как рост кроликов влияет на индукцию фага и появление колоний, продуцирующих β-токсин.В крови и селезенке инфицированных животных частота колоний, продуцирующих β-токсин, увеличивалась по сравнению с лабораторными условиями выращивания. Частоты были аналогичны таковым после выращивания в бульоне BH при 37–42 ° C. Самые высокие частоты были обнаружены у бактерий, выделенных из эндокардитных вегетаций (1/30), ишемической печени (1/30) и абсцессов почек (1/40). Эти результаты показывают, что индукция фагов благоприятствует во время роста в определенных нишах, а β-токсин вносит значительный вклад в прогрессирование заболевания тканей.

    Вклад β-токсина в носовую колонизацию человека S. aureus был продемонстрирован при сравнении S. aureus NCTC 8325-4 (содержащего интактный ген β-токсина) с производным, несущим φSa3 [49]. Штамм, продуцирующий β-токсин, сохранялся 14 дней, в то время как штамм, несущий φSa3, сохранялся 4 дня. Следовательно, продукция β-токсина, как и в клональной линии USA200, значительно способствует способности S. aureus колонизировать слизистые оболочки. Штаммы группы USA200 также связаны с пневмонией, а β-токсин может способствовать заболеванию легких [23].Штамм USA400 MW2, изолят летальной пневмонии человека, продуцирует варианты, которые теряют φSa3 и секретируют β-токсин в больших количествах, аналогично штаммам NCTC 8325-4 и RN4220 (продуцирующим до 500 мкг / мл) [23]. Эти варианты (называемые MW2 hyper-β) при интратрахеальном введении кроликам вызывают образование крупных гранулематозных поражений легких, содержащих жизнеспособные бактерии, которые образуют каверну, вызывая массивные геморрагические плевральные выпоты и уплотнения. Эти наблюдения показывают, что β-токсин вносит значительный вклад в патологию S.aureus пневмония.

    В двух исследованиях задокументированы варианты, продуцирующие β-токсин, в мокроте пациентов с МВ [32, 33]. Эти пациенты имеют хроническую инфекцию легких, вызванную S. aureus , и регулярно получают лечение антибиотиками. Удаление фагов и геномные изменения являются результатом селективного давления антибиотикотерапии и ответов хозяина [34]. Стафилококковый эндокардит — это инфекция сердца, преимущественно клапанов, часто приводящая к септическим эмболам и метастатическим абсцессам [5].В нашей модели кролика вегетация развивается в течение 4 дней, и давление отбора исходит исключительно от среды хозяина. Исследования со штаммом COL S. aureus показали, что β-токсин необходим для формирования растительности [23]. Мы предоставляем дополнительные доказательства роли β-токсина в эндокардите, поскольку гипер-β вариант MW2 дает более крупные растения, чем растения дикого типа MW2. Хотя в варианте гипер-β растительность крупнее, она не содержит более высоких бактериальных нагрузок. Мы прогнозируем активность β-токсинлигазы, которая катализирует образование нуклеопротеиновых комплексов во внеклеточном матриксе, необходимом для роста растений, индуцирует агрегацию факторов хозяина независимо от скорости, с которой S.aureus размножается. Варианты, продуцирующие β-токсин, увеличиваются в частоте среди вегетаций, абсцессов почек и ишемической печени во время инфицирования родительским MW2. Если экспрессия β-токсина (в отсутствие φSa3; MW2 hyper-β) приводит к секреции 500 мкг / мл β-токсина, по нашим оценкам, в растениях уровни β-токсина могут составлять 15 мкг / мл, а в кровь, 3 мкг / мл.

    S. aureus часто считается оппортунистом как у людей, так и у животных. Фаг, превращающий β-токсин, φSa3, широко распространен среди S.aureus человеческого происхождения по сравнению со штаммами крупного рогатого скота [34]. φSa3 кодирует суперантигены (SE -1- K, SE -1- Q и SEA) и предполагаемые факторы уклонения от врожденного иммунитета (SAK, CHIP и SCIN) [26, 28, 29, 50]. Предполагалось, что, поскольку φSa3 инактивирует ген β-токсина, приобретение φSa3 более выгодно для S. aureus , чем продукция β-токсина, и, следовательно, β-токсин не вносит значительного вклада в патогенез. Мы предоставляем доказательства того, что варианты β-токсина встречаются в штаммах, несущих φSa3, и что индукция φSa3 происходит во время активной инфекции и дифференцированно индуцируется в зависимости от экологической ниши.Наше исследование способствует пониманию роли β-токсина в заболевании и подчеркивает динамическое взаимодействие между S. aureus и хозяином, где φSa3 обеспечивает новый регуляторный механизм для экспрессии гена вирулентности и повышения приспособленности.

    Банкноты

    Финансовая поддержка. Эта работа была поддержана Стартапом Медицинского колледжа Университета Айовы Карвер в компании P.M.S. W.S.P. был поддержан грантом на обучение T32AI007511 Службы общественного здравоохранения США (USPHS), предоставленным Национальным институтом аллергии и инфекционных заболеваний.

    Возможный конфликт интересов. Все авторы: о конфликтах не сообщалось.

    Все авторы подали форму ICMJE для раскрытия информации о потенциальных конфликтах интересов. Выявлены конфликты, которые редакция считает относящимися к содержанию рукописи.

    Список литературы

    1

    Klevens

    RM

    ,

    Morrison

    MA

    ,

    Nadle

    J

    и др.

    Инвазивные метициллин-устойчивые Staphylococcus aureus инфекции в США

    ,

    JAMA

    ,

    2007

    , vol.

    298

    (стр.

    1763

    71

    ) 2

    Fowler

    VG

    Jr.,

    Miro

    JM

    ,

    Hoen

    B

    и др.

    Staphylococcus aureus Эндокардит: следствие медицинского прогресса

    ,

    JAMA

    ,

    2005

    , vol.

    293

    (стр.

    3012

    21

    ) 3

    Мердок

    DR

    ,

    Кори

    GR

    ,

    Hoen

    B

    и др.

    Клинические проявления, этиология и исходы инфекционного эндокардита в 21 веке: международное сотрудничество по эндокардиту — проспективное когортное исследование

    ,

    Arch Intern Med

    ,

    2009

    , vol.

    169

    (стр.

    463

    73

    ) 4

    Шорр

    AF

    ,

    Табак

    YP

    ,

    Киллиан

    AD

    и др.

    Инфекция кровотока, связанная со здравоохранением: отдельная сущность? Информация из большой базы данных США

    ,

    Crit Care Med

    ,

    2006

    , vol.

    34

    (стр.

    2588

    95

    ) 5

    Сполдинг

    AR

    ,

    Сальгадо-Пабон

    W

    ,

    Колер

    PL

    и др.

    Суперантигенные экзотоксины стафилококков и стрептококков

    ,

    Clin Microbiol Rev

    ,

    2013

    , vol.

    26

    (стр.

    422

    47

    ) 6

    Wisplinghoff

    H

    ,

    Bischoff

    T

    ,

    Tallent

    SM

    и др.

    Нозокомиальные инфекции кровотока в больницах США: анализ 24 179 случаев из проспективного общенационального эпиднадзора

    ,

    Clin Infect Dis

    ,

    2004

    , vol.

    39

    (стр.

    309

    17

    ) 7

    Boucher

    H

    ,

    Miller

    LG

    ,

    Razonable

    RR

    .

    Серьезные инфекции, вызванные устойчивостью к метициллину Staphylococcus aureus

    ,

    Clin Infect Dis

    ,

    2010

    , vol.

    51

    Дополнение 2

    (стр.

    S183

    97

    ) 8

    Динги

    MM

    ,

    Orwin

    PM

    ,

    Schlievert

    PM

    .

    Экзотоксины Staphylococcus aureus

    ,

    Clin Microbiol Rev

    ,

    2000

    , т.

    13

    (стр.

    16

    34

    ) 9

    Lowy

    FD

    .

    Staphylococcus aureus инфекции

    ,

    N Engl J Med

    ,

    1998

    , vol.

    339

    (стр.

    520

    32

    ) 10

    Doery

    HM

    ,

    Magnusson

    BJ

    ,

    Cheyne

    IM

    ,

    Sulasekharam

    Фосфолипаза в стафилококковом токсине, которая гидролизует сфингомиелин

    ,

    Nature

    ,

    1963

    , vol.

    198

    (стр.

    1091

    2

    ) 11

    Doery

    HM

    ,

    Magnusson

    BJ

    ,

    Gulasekharam

    J

    ,

    PearsonE

    J.

    Свойства ферментов фосфолипазы в стафилококковых токсинах

    ,

    J Gen Microbiol

    ,

    1965

    , vol.

    40

    (стр.

    283

    96

    ) 12

    Валев

    I

    ,

    Веллер

    U

    ,

    Strauch

    S

    ,

    Foster

    T

    hak2,

    ,

    Селективное уничтожение моноцитов человека и высвобождение цитокинов, вызванное сфингомиелиназой (бета-токсином) Staphylococcus aureus

    ,

    Infect Immun

    ,

    1996

    , vol.

    64

    (стр.

    2974

    9

    ) 13

    Marshall

    MJ

    ,

    Bohach

    GA

    ,

    Boehm

    DF

    .

    Характеристика Staphylococcus aureus Лейкотоксичность, вызванная бета-токсинами

    ,

    J Nat Toxins

    ,

    2000

    , vol.

    9

    (стр.

    125

    38

    ) 14

    Катаяма

    Y

    ,

    Baba

    T

    ,

    Sekine

    M

    ,

    Fukuda

    M

    0002 9000ramat

    Бета-гемолизин способствует колонизации кожи Staphylococcus aureus

    ,

    J Bacteriol

    ,

    2013

    , vol.

    195

    (стр.

    1194

    203

    ) 15

    Маррак

    P

    ,

    Капплер

    J

    .

    Стафилококковые энтеротоксины и их родственники

    ,

    Science

    ,

    1990

    , vol.

    248

    стр.

    1066

    16

    Huseby

    M

    ,

    Shi

    K

    ,

    Brown

    CK

    и др.

    Структура и биологическая активность бета-токсина из Staphylococcus aureus

    ,

    J Bacteriol

    ,

    2007

    , vol.

    189

    (стр.

    8719

    26

    ) 17

    Hebert

    GA

    ,

    Hancock

    GA

    .

    Синергетический гемолиз, проявляемый видами стафилококков

    ,

    J Clin Microbiol

    ,

    1985

    , vol.

    22

    (стр.

    409

    15

    ) 18

    Cheung

    GY

    ,

    Duong

    AC

    ,

    Otto

    M

    .

    Прямой и синергический гемолиз, вызываемый Staphylococcus фенолорастворимыми модулянами: значение для диагностики и патогенеза

    ,

    Microbes Infect

    ,

    2012

    , vol.

    14

    (стр.

    380

    6

    ) 19

    Hedstrom

    SA

    ,

    Malmqvist

    T

    .

    Сфингомиелиназная активность Staphylococcus aureus штаммов рецидивирующего фурункулеза и других инфекций

    ,

    Acta Pathol Microbiol Immunol Scand B

    ,

    1982

    , vol.

    90

    (стр.

    217

    20

    ) 20

    Diep

    BA

    ,

    Carleton

    HA

    ,

    Chang

    RF

    ,

    Sensabaugh

    ton

    000 Reming2000 GF

    ,

    .

    Роль 34 генов вирулентности в эволюции стационарных и местных штаммов метициллин-резистентных Staphylococcus aureus

    ,

    J Infect Dis

    ,

    2006

    , vol.

    193

    (стр.

    1495

    503

    ) 21

    О’Каллаган

    RJ

    ,

    Каллеган

    MC

    ,

    Моро

    JM

    и др.

    Особые роли альфа-токсина и бета-токсина при Staphylococcus aureus инфекции роговицы

    ,

    Infect Immun

    ,

    1997

    , vol.

    65

    (стр.

    1571

    8

    ) 22

    Aarestrup

    FM

    ,

    Larsen

    HD

    ,

    Eriksen

    NH

    ,

    Elsberg CS

    9000

    Jense

    NE

    .

    Частота альфа- и бета-гемолизина в золотистом стафилококке крупного рогатого скота и человека. Сравнение фенотипа и генотипа и вариации фенотипической экспрессии

    ,

    Apmis

    ,

    1999

    , vol.

    107

    (стр.

    425

    30

    ) 23

    Huseby

    MJ

    ,

    Kruse

    AC

    ,

    Digre

    J

    и др.

    Бета-токсин катализирует образование нуклеопротеинового матрикса в стафилококковых биопленках

    ,

    Proc Natl Acad Sci USA

    ,

    2010

    , vol.

    107

    (стр.

    14407

    12

    ) 24

    Винклер

    KC

    ,

    de Waart

    J

    ,

    Grootsen

    C

    .

    Лизогенное превращение стафилококков в потерю бета-токсина

    ,

    J Gen Microbiol

    ,

    1965

    , vol.

    39

    (стр.

    321

    33

    ) 25

    Coleman

    DC

    ,

    Arbuthnott

    JP

    ,

    Pomeroy

    HM

    ,

    Birkbeck TH

    Клонирование и экспрессия в Escherichia coli и Staphylococcus aureus детерминанты бета-лизина из Staphylococcus aureus : доказательство того, что бактериофаговая конверсия активности бета-лизина вызвана инсерционной инактивацией детерминанты бета-лизина

    ,

    Патог

    ,

    1986

    , т.

    1

    (стр.

    549

    64

    ) 26

    Коулман

    DC

    ,

    Салливан

    DJ

    ,

    Рассел

    RJ

    и др.

    Staphylococcus aureus бактериофаги, опосредующие одновременное лизогенное превращение бета-лизина, стафилокиназы и энтеротоксина A: молекулярный механизм тройного превращения

    ,

    J Gen Microbiol

    ,

    1989

    , vol.

    135

    (стр.

    1679

    97

    ) 27

    Забицка

    D

    ,

    Млынарчик

    A

    ,

    Windyga

    B

    ,

    0002 Glynarczyk

    .

    Фаговая конверсия энтеротоксина А, стафилокиназы и бета-токсина в Staphylococcus aureus

    ,

    Acta Microbiol Pol

    ,

    1993

    , vol.

    42

    (стр.

    235

    41

    ) 28

    de Haas

    CJ

    ,

    Veldkamp

    KE

    ,

    Peschel

    A

    и др.

    Белок, ингибирующий хемотаксис Staphylococcus aureus , бактериальный противовоспалительный агент

    ,

    J Exp Med

    ,

    2004

    , vol.

    199

    (стр.

    687

    95

    ) 29

    Rooijakkers

    SH

    ,

    Ruyken

    M

    ,

    Roos

    A

    и др.

    Уклонение от иммунитета с помощью ингибитора стафилококкового комплемента, который действует на C3-конвертазы

    ,

    Nat Immunol

    ,

    2005

    , vol.

    6

    (стр.

    920

    7

    ) 30

    фургон Wamel

    WJ

    ,

    Rooijakkers

    SH

    ,

    Ruyken

    M

    ,

    фургон Strijp

    0003 Kessel

    JA

    .

    Модуляторы врожденного иммунитета, стафилококковый комплемент и белок, ингибирующий хемотаксис Staphylococcus aureus , расположены на бета-гемолизин-превращающих бактериофагах

    ,

    J Bacteriol

    ,

    2006

    , vol.

    188

    (стр.

    1310

    5

    ) 31

    Goerke

    C

    ,

    Gressinger

    M

    ,

    Endler

    K

    и др.

    Высокое фенотипическое разнообразие при заражении, но не при заселении Staphylococcus aureus популяций

    ,

    Environ Microbiol

    ,

    2007

    , vol.

    9

    (стр.

    3134

    42

    ) 32

    Goerke

    C

    ,

    Matias y Papenberg

    S

    ,

    Dasbach

    S

    и др.

    Повышенная частота геномных изменений у Staphylococcus aureus во время хронической инфекции частично связана с мобилизацией фагов

    ,

    J Infect Dis

    ,

    2004

    , vol.

    189

    (стр.

    724

    34

    ) 33

    Goerke

    C

    ,

    Wirtz

    C

    ,

    Fluckiger

    U

    ,

    Wolz

    C

    C

    C

    Обширная фаговая динамика в Staphylococcus aureus способствует адаптации к человеку-хозяину во время инфекции

    ,

    Mol Microbiol

    ,

    2006

    , vol.

    61

    (стр.

    1673

    85

    ) 34

    Goerke

    C

    ,

    Koller

    J

    ,

    Wolz

    C

    .

    Ципрофлоксацин и триметоприм вызывают индукцию фагов и модуляцию вирулентности у Staphylococcus aureus

    ,

    Противомикробные агенты Chemother

    ,

    2006

    , vol.

    50

    (стр.

    171

    7

    ) 35

    Из Центров по контролю и профилактике заболеваний

    Четыре педиатрических случая смерти от внебольничных метициллин-устойчивых Staphylococcus aureus — Миннесота и Северная Дакота, 1997–1999 гг.,

    , 1997–1999 ,

    JAMA

    ,

    1999

    , т.

    282

    (стр.

    1123

    5

    ) 36

    Четыре случая смерти детей от внебольничной метициллин-резистентности Staphylococcus aureus — Миннесота и Северная Дакота, 1997–1999

    ,

    MMWR Morb Mortal Wkly 1999

    , т.

    48

    (стр.

    707

    10

    ) 37

    Сполдинг

    AR

    ,

    Lin

    YC

    ,

    Merriman

    JA

    и др.

    Иммунитет к Staphylococcus aureus секретируемых белков защищает кроликов от серьезных заболеваний

    ,

    Vaccine

    ,

    2012

    , vol.

    30

    (стр.

    5099

    109

    ) 38

    Сполдинг

    AR

    ,

    Satterwhite

    EA

    ,

    Lin

    YC

    и др.

    Сравнение штаммов Staphylococcus aureus по способности вызывать инфекционный эндокардит и летальный сепсис у кроликов

    ,

    Front Cell Infect Microbiol

    ,

    2012

    , vol.

    2

    стр.

    18

    39

    Салгадо-Пабон

    W

    ,

    Breshears

    L

    ,

    Spaulding

    AR

    , et al.

    Суперантигены критически важны для Staphylococcus aureus инфекционного эндокардита, сепсиса и острого повреждения почек

    ,

    MBio

    ,

    2013

    , vol.

    4

    (стр.

    e00494

    13

    ) 40

    Blomster-Hautamaa

    DA

    ,

    Schlievert

    PM

    .

    Препарат токсина-1 синдрома токсического шока

    ,

    Методы Энзимол

    ,

    1988

    , т.

    165

    (стр.

    37

    43

    ) 41

    Schlievert

    PM

    ,

    Case

    LC

    ,

    Nemeth

    KA

    и др.

    Альфа- и бета-цепи гемоглобина подавляют продукцию Staphylococcus aureus экзотоксинов

    ,

    Биохимия

    ,

    2007

    , vol.

    46

    (стр.

    14349

    58

    ) 42

    Geisinger

    E

    ,

    Chen

    J

    ,

    Novick

    RP

    .

    Аллель-зависимые различия в динамике восприятия кворума приводят к вариантной экспрессии генов вирулентности у Staphylococcus aureus

    ,

    J Bacteriol

    ,

    2012

    , vol.

    194

    (стр.

    2854

    64

    ) 43

    MacDonald

    KL

    ,

    Остерхольм

    MT

    ,

    Hedberg

    CW

    и др.

    Синдром токсического шока. Недавно признанное осложнение гриппа и гриппоподобного заболевания

    ,

    Jama

    ,

    1987

    , vol.

    257

    (стр.

    1053

    8

    ) 44

    Hayashida

    A

    ,

    Bartlett

    AH

    ,

    Foster

    TJ

    ,

    Park

    PW

    PW

    .

    Staphylococcus aureus бета-токсин вызывает повреждение легких через синдекан-1

    ,

    Am J Pathol

    ,

    2009

    , vol.

    174

    (стр.

    509

    18

    ) 45

    Brosnahan

    AJ

    ,

    Mantz

    MJ

    ,

    Squier

    CA

    ,

    Peterson

    Peterson

    Peterson ML

    Цитолизины увеличивают проникновение суперантигенов в многослойную слизистую оболочку

    ,

    J Immunol

    ,

    2009

    , vol.

    182

    (стр.

    2364

    73

    ) 46

    Veeh

    RH

    ,

    Shirtliff

    ME

    ,

    Petik

    JR

    и др.

    Обнаружение Staphylococcus aureus биопленки на тампонах и компонентах менструального цикла

    ,

    J Infect Dis

    ,

    2003

    , vol.

    188

    (стр.

    519

    30

    ) 47

    Пантучек

    R

    ,

    Doskar

    J

    ,

    Ruzickova

    V

    и др.

    Идентификация типов бактериофагов и их носительство в Staphylococcus aureus

    ,

    Arch Virol

    ,

    2004

    , vol.

    149

    (стр.

    1689

    703

    ) 48

    Jin

    T

    ,

    Bokarewa

    M

    ,

    McIntyre

    L

    и др.

    Летальный исход пациентов с бактериемией в результате инфицирования стафилокиназодефицитными штаммами Staphylococcus aureus

    ,

    J Med Microbiol

    ,

    2003

    , vol.

    52

    (стр.

    919

    23

    ) 49

    Verkaik

    NJ

    ,

    Benard

    M

    ,

    Boelens

    HA

    и др.

    Бактериофаги, положительные по кластеру иммунного уклонения, широко распространены среди человеческих штаммов Staphylococcus aureus , но они не важны на первых этапах носовой колонизации

    ,

    Clin Microbiol Infect

    ,

    2011

    , vol.

    17

    (стр.

    343

    8

    ) 50

    Iandolo

    JJ

    ,

    Worrell

    V

    ,

    Groicher

    KH

    и др.

    Сравнительный анализ геномов умеренных бактериофагов phi 11, phi 12 и phi 13 Staphylococcus aureus 8325

    ,

    Gene

    ,

    2002

    , vol.

    289

    (стр.

    109

    18

    ) © Автор, 2014. Опубликовано Oxford University Press от имени Общества инфекционистов Америки. Все права защищены. Для получения разрешений обращайтесь по электронной почте: [email protected]

    Генотипический и фенотипический анализ клинических изолятов Staphylococcus aureus выявил модели продуцирования и гемолитические потенциалы, не связанные с профилями генов и источником | BMC Microbiology

  • 1.

    Gagliotti C, Balode A, Baquero F, Degener J, Grundmann H, Gür D, et al. Escherichia coli и Staphylococcus aureus : плохие новости и хорошие новости от Европейской сети по надзору за устойчивостью к противомикробным препаратам (EARS-Net, ранее EARSS), 2002–2009 годы. Euro Surveill Bull Eur Sur Mal Transm Eur Commun Dis Bull. 2011; 16 (11).

  • 2.

    Spaulding AR, Salgado-Pabón W, Kohler PL, Horswill AR, Leung DYM, Schlievert PM. Стафилококковые и стрептококковые суперантигенные экзотоксины.Clin Microbiol Rev.2013; 26: 422–47.

    PubMed Central Статья CAS PubMed Google Scholar

  • 3.

    Otter JA, French GL. Молекулярная эпидемиология ассоциированного с сообществами метициллин-устойчивого Staphylococcus aureus в Европе. Lancet Infect Dis. 2010; 10: 227–39.

    Артикул PubMed Google Scholar

  • 4.

    ВОЗ — Устойчивость к противомикробным препаратам: глобальный отчет по эпиднадзору, 2014 г. [http: // www.who.int/drugresistance/documents/surveillancereport/en/]

  • 5.

    ДеВрис А.С., Лешер Л., Шливерт П.М., Роджерс Т., Виллом Л.Г., Данила Р. и др. Синдром стафилококкового токсического шока 2000–2006 гг .: эпидемиология, клинические и молекулярные характеристики. PLoS One. 2011; 6: e22997.

    PubMed Central Статья CAS PubMed Google Scholar

  • 6.

    Пикок С.Дж., Мур К.Э., Джастис А., Канцану М., Стори Л., Маки К. и др.Вирулентные комбинации генов адгезина и токсина в природных популяциях Staphylococcus aureus . Infect Immun. 2002; 70: 4987–96.

    PubMed Central Статья CAS PubMed Google Scholar

  • 7.

    Chavakis T, Preissner KT, Herrmann M. Противовоспалительная активность Staphylococcus aureus . Trends Immunol. 2007. 28: 408–18.

    Артикул CAS PubMed Google Scholar

  • 8.

    Foster TJ, Geoghegan JA, Ganesh VK, Höök M. Адгезия, инвазия и уклонение: многие функции поверхностных белков Staphylococcus aureus . Nat Rev Microbiol. 2014; 12: 49–62.

    Артикул CAS PubMed Google Scholar

  • 9.

    Фэн И, Чен Си-Дж, Су Л-Х, Ху С, Ю Дж, Чиу Ч. Эволюция и патогенез золотистого стафилококка : уроки, извлеченные из генотипирования и сравнительной геномики.FEMS Microbiol Rev.2008; 32: 23–37.

    Артикул CAS PubMed Google Scholar

  • 10.

    Линдси Дж. А., Рузин А., Росс Х. Ф., Курепина Н., Новик Р. П.. Ген токсического шока переносится семейством мобильных островков патогенности в Staphylococcus aureus . Mol Microbiol. 1998. 29: 527–43.

    Артикул CAS PubMed Google Scholar

  • 11.

    Новик Р.П., Шливерт П., Рузин А. Острова патогенности и устойчивости стафилококков. Микробы заражают Inst Pasteur. 2001; 3: 585–94.

    Артикул CAS Google Scholar

  • 12.

    Spaulding AR, Salgado-Pabón W, Merriman JA, Stach CS, Ji Y, Gillman AN, et al. Вакцинация против золотистого стафилококка пневмонии. J Infect Dis. 2014; 209: 1955–62.

    PubMed Central Статья CAS PubMed Google Scholar

  • 13.

    Vandenesch F, Lina G, Henry T. Staphylococcus aureus Гемолизины, двухкомпонентные лейкоцидины и цитолитические пептиды: избыточный арсенал факторов вирулентности, повреждающих мембраны? Front Cell Infect Microbiol. 2012; 2: 12.

    PubMed Central Статья PubMed Google Scholar

  • 14.

    Андерсон М.Дж., Линь YC, Гиллман А.Н., Паркс П.Дж., Шливерт П.М., Петерсон М.Л. Альфа-токсин Staphylococcus aureus способствует образованию биопленки слизистой оболочки.Front Cell Infect Microbiol. 2012; 2: 64.

    PubMed Central Статья PubMed Google Scholar

  • 15.

    Финк-Барбансон В., Превост Г., Пьемонт Ю. Улучшенная очистка лейкоцидина от Staphylococcus aureus и распределение токсинов среди больничных штаммов. Res Microbiol. 1991. 142: 75–85.

    Артикул PubMed Google Scholar

  • 16.

    Vu BG, Stach CS, Salgado-Pabón W, Diekema DJ, Gardner SE, Schlievert PM.Суперантигены Staphylococcus aureus от пациентов с диабетической язвой стопы. J Infect Dis. 2014; 210: 1920.

    PubMed Central Статья PubMed Google Scholar

  • 17.

    Ферри Т., Томас Д., Дженестье А.-Л, Бес М., Лина Г., Ванденеш Ф. и др. Сравнительная распространенность суперантигенных генов у изолятов Staphylococcus aureus , вызывающих сепсис с септическим шоком и без него. Clin Infect Dis Off Publ Infect Dis Soc Am.2005; 41: 771–7.

    Артикул CAS Google Scholar

  • 18.

    Varshney AK, Mediavilla JR, Robiou N, Guh A, Wang X, Gialanella P, et al. Различные профили генов энтеротоксина среди клональных комплексов изолятов Staphylococcus aureus из Бронкса, Нью-Йорк. Appl Environ Microbiol. 2009. 75: 6839–49.

    PubMed Central Статья CAS PubMed Google Scholar

  • 19.

    Becker K, Friedrich AW, Lubritz G, Weilert M, Peters G, Von Eiff C. Распространенность генов, кодирующих суперантигены пирогенных токсинов и эксфолиативных токсинов среди штаммов Staphylococcus aureus , выделенных из крови и образцов из носа. J Clin Microbiol. 2003; 41: 1434–9.

    PubMed Central Статья CAS PubMed Google Scholar

  • 20.

    Xie Y, He Y, Gehring A, Hu Y, Li Q, Tu S-I, et al. Генотипы и профили токсиновых генов клинических изолятов Staphylococcus aureus из Китая.PLoS One. 2011; 6, e28276.

    PubMed Central Статья CAS PubMed Google Scholar

  • 21.

    Шукла С.К., Кароу М.Э., Брэди Дж. М., Стемпер М. Е., Кислоу Дж., Мур Н. и др. Гены вирулентности и генотипические ассоциации при носительстве через нос, ассоциированные с сообществом метициллин-чувствительные и метициллин-устойчивые изоляты USA400 Staphylococcus aureus . J Clin Microbiol. 2010. 48: 3582–92.

    PubMed Central Статья CAS PubMed Google Scholar

  • 22.

    Van Trijp MJCA, Melles DC, Snijders SV, Wertheim HFL, Verbrugh HA, van Belkum A, et al. Генотипы, профили суперантигенных генов и наличие эксфолиативных генов токсинов в клинических изолятах Staphylococcus aureus , чувствительных к метициллину. Диагностика Microbiol Infect Dis. 2010; 66: 222–4.

    Артикул PubMed Google Scholar

  • 23.

    Derzelle S, Dilasser F, Duquenne M, Deperrois V. Дифференциальная временная экспрессия генов стафилококковых энтеротоксинов во время роста клеток.Food Microbiol. 2009; 26: 896–904.

    Артикул CAS PubMed Google Scholar

  • 24.

    Буриан М., Раутенберг М., Колер Т., Фриц М., Крисмер Б., Унгер С. и др. Временная экспрессия факторов адгезии и активность глобальных регуляторов во время установления носовой колонизации Staphylococcus aureus . J Infect Dis. 2010; 201: 1414–21.

    Артикул CAS PubMed Google Scholar

  • 25.

    Schlievert PM, Case LC, Strandberg KL, Abrams BB, Leung DYM. Суперантигенный профиль изолятов Staphylococcus aureus от пациентов со стероидорезистентным атопическим дерматитом. Clin Infect Dis Off Publ Infect Dis Soc Am. 2008; 46: 1562–7.

    Артикул Google Scholar

  • 26.

    Сакаи Ф., Ихара Х., Аояма К., Игараси Х., Янахира С., Окубо Т. и др. Характеристики энтеротоксина H-продуцента Staphylococcus aureus , выделенного из клинических случаев, и свойства продуктивности энтеротоксина.J Food Prot. 2008; 71: 1855–60.

    PubMed Google Scholar

  • 27.

    Агилар Дж. Л., Варшней А. К., Ван Х, Стэнфорд Л., Шарфф М., Фрайс Б. Обнаружение и измерение секреции стафилококкового энтеротоксин-подобного K (SE1-K) клиническими изолятами Staphylococcus aureus . J Clin Microbiol. 2014; 52: 2536–43.

    PubMed Central Статья PubMed Google Scholar

  • 28.

    Li M, Cheung GYC, Hu J, Wang D, Joo H-S, Deleo FR и др. Сравнительный анализ вирулентности и экспрессии токсинов глобальных сообществ устойчивых к метициллину штаммов Staphylococcus aureus . J Infect Dis. 2010; 202: 1866–76.

    PubMed Central Статья CAS PubMed Google Scholar

  • 29.

    Гамильтон С.М., Брайант А.Э., Кэрролл К.С., Локкари В., Ма И., МакИнду Е. и др. Производство in vitro пантон-валентинского лейкоцидина среди штаммов метициллин-резистентных штаммов Staphylococcus aureus , вызывающих различные инфекции.Clin Infect Dis Off Publ Infect Dis Soc Am. 2007. 45: 1550–8.

    Артикул CAS Google Scholar

  • 30.

    Sharma-Kuinkel BK, Wu Y, Tabor DE, Mok H, Sellman BR, Jenkins A, et al. Характеристика вариантов гена альфа-токсина hla , уровни экспрессии альфа-токсина и уровни антител к альфа-токсину у гемодиализных и послеоперационных пациентов с бактериемией Staphylococcus aureus . J Clin Microbiol. 2015; 53: 227–36.

    PubMed Central Статья CAS PubMed Google Scholar

  • 31.

    Bartels MD, Petersen A, Worning P, Nielsen JB, Larner-Svensson H, Johansen HK, et al. Сравнение полногеномного секвенирования с секвенированием по Сэнгеру для спа-типирования метициллин-устойчивого Staphylococcus aureus . J Clin Microbiol. 2014; 52: 4305–8.

    PubMed Central Статья PubMed Google Scholar

  • 32.

    Энрайт MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Мультилокусное типирование последовательностей для характеристики метициллин-устойчивых и метициллин-чувствительных клонов Staphylococcus aureus . J Clin Microbiol. 2000; 38: 1008–15.

    PubMed Central CAS PubMed Google Scholar

  • 33.

    Бэнкс М.С., Камел Н.С., Забриски Дж.Б., Лароне Д.Х., Урси Д., Познетт Д.Н. Staphylococcus aureus экспрессируют уникальные суперантигены в зависимости от источника ткани.J Infect Dis. 2003. 187: 77–86.

    Артикул CAS PubMed Google Scholar

  • 34.

    Stich N, Model N, Samstag A, Gruener CS, Wolf HM, Eibl MM. Опосредованная токсином-1 токсичность синдрома токсического шока подавляется нейтрализующими антителами на поздних этапах непрерывного воздействия in vivo и in vitro. Токсины. 2014; 6: 1724–41.

    PubMed Central Статья CAS PubMed Google Scholar

  • 35.

    Кантор Л., Факрелл HB. Стареющие эритроциты проявляют однократный ответ на стафилококковый альфа-токсин. Геронтология. 1998. 44: 26–31.

    Артикул CAS PubMed Google Scholar

  • 36.

    Маруччи А.А. Механизм действия стафилококкового альфа-гемолизина. I. Некоторые факторы, влияющие на измерение альфа-гемолизина. J Bacteriol. 1963; 86: 1182–8.

    PubMed Central CAS PubMed Google Scholar

  • 37.

    O’Reilly M, Kreiswirth B, Foster TJ. Ген скрытого альфа-токсина при синдроме токсического шока и штаммах сепсиса Staphylococcus aureus . Mol Microbiol. 1990; 4: 1947–55.

    Артикул PubMed Google Scholar

  • 38.

    Thomas DY, Jarraud S, Lemercier B, Cozon G, Echasserieau K, Etienne J, et al. Стафилококковые энтеротоксиноподобные токсины U2 и V, два новых стафилококковых суперантигена, возникающих в результате рекомбинации внутри кластера генов энтеротоксина.Infect Immun. 2006. 74: 4724–34.

    PubMed Central Статья CAS PubMed Google Scholar

  • 39.

    Rieg S, Jonas D, Kaasch AJ, Porzelius C, Peyerl-Hoffmann G, Theilacker C, et al. Генотипирование на основе микрочипов и клинические результаты инфекции кровотока Staphylococcus aureus : предварительное исследование. PLoS One. 2013; 8: e71259.

    PubMed Central Статья CAS PubMed Google Scholar

  • 40.

    Strandberg KL, Rotschafer JH, Vetter SM, Buonpane RA, Kranz DM, Schlievert PM. Стафилококковые суперантигены вызывают у кроликов летальную болезнь легких. J Infect Dis. 2010; 202: 1690–7.

    PubMed Central Статья PubMed Google Scholar

  • 41.

    Прагман А.А., Ярвуд Дж. М., Трипп Т. Дж., Шливерт П. М.. Характеристика регуляции фактора вирулентности с помощью SrrAB, двухкомпонентной системы в Staphylococcus aureus . J Bacteriol.2004; 186: 2430–8.

    PubMed Central Статья CAS PubMed Google Scholar

  • 42.

    Окумура К., Шимомура Ю., Мураяма С.И., Яги Дж., Убуката К., Кирика Т. и др. Пути эволюции стрептококковых и стафилококковых суперантигенов. BMC Genomics. 2012; 13: 404.

    PubMed Central Статья CAS PubMed Google Scholar

  • 43.

    Уилсон Г.Дж., Сео К.С., Картрайт Р.А., Коннелли Т., Чуанг-Смит О.Н., Мерриман Дж. А. и др.Новый суперантиген, кодируемый ядром генома, способствует летальности некротической пневмонии, ассоциированной с MRSA. PLoS Pathog. 2011; 7: e1002271.

    PubMed Central Статья CAS PubMed Google Scholar

  • 44.

    Джи Джи, Бивис Р., Новик Р.П. Бактериальное вмешательство, вызванное аутоиндуцирующими вариантами пептида. Наука. 1997; 276: 2027–30.

    Артикул CAS PubMed Google Scholar

  • 45.

    Salgado-Pabón W, Herrera A, Vu BG, Stach CS, Merriman JA, Spaulding AR и др. Staphylococcus aureus Производство β-токсина является обычным для штаммов с геном β-токсина, инактивированным бактериофагом. J Infect Dis. 2014; 210: 784–92.

    PubMed Central Статья PubMed Google Scholar

  • 46.

    Чоу А.В., Гриббл М.Дж., Бартлетт К.Х. Характеристика гемолитической активности штаммов Staphylococcus aureus , ассоциированных с синдромом токсического шока.J Clin Microbiol. 1983; 17: 524–8.

    PubMed Central CAS PubMed Google Scholar

  • 47.

    Schlievert PM, Osterholm MT, Kelly JA, Nishimura RD. Характеристика токсинов и ферментов изолятов Staphylococcus aureus от пациентов с синдромом токсического шока и без него. Ann Intern Med. 1982; 96 (6 Pt 2): 937–40.

    Артикул CAS PubMed Google Scholar

  • 48.

    Christensson B, Hedström SA. Биохимические и биологические свойства штаммов Staphylococcus aureus septicemia в зависимости от клинических характеристик. Scand J Infect Dis. 1986; 18: 297–303.

    Артикул CAS PubMed Google Scholar

  • 49.

    Клайн М., Де Азаведо Дж., Карлсон Э., Арбутнотт Дж. Производство гамма-гемолизина и отсутствие продукции альфа-гемолизина штаммами Staphylococcus aureus , ассоциированными с синдромом токсического шока.J Clin Microbiol. 1988; 26: 535–9.

    PubMed Central CAS PubMed Google Scholar

  • 50.

    Li S, Arvidson S, Möllby R. Вариация зависимой от agr экспрессии альфа-токсина и протеина A среди клинических изолятов Staphylococcus aureus от пациентов с сепсисом. FEMS Microbiol Lett. 1997. 152: 155–61.

    Артикул CAS PubMed Google Scholar

  • 51.

    ДеЛео FR, Кеннеди А.Д., Чен Л., Бубек Варденбург Дж., Кобаяши С.Д., Матема Б и др. Молекулярная дифференциация исторического фага типа 80/81 и современной эпидемии Staphylococcus aureus . Proc Natl Acad Sci U S. A. 2011; 108: 18091–6.

    PubMed Central Статья CAS PubMed Google Scholar

  • 52.

    Holmes NE, Turnidge JD, Munckhof WJ, Robinson JO, Korman TM, O’Sullivan MVN, et al. Генетические и молекулярные предикторы высокой МПК ванкомицина в изолятах бактериемии Staphylococcus aureus .J Clin Microbiol. 2014; 52: 3384–93.

    PubMed Central Статья CAS PubMed Google Scholar

  • 53.

    Xiong YQ, Willard J, Yeaman MR, Cheung AL, Bayer AS. Регулирование экспрессии гена альфа-токсина Staphylococcus aureus ( hla ) с помощью agr , sarA и sae in vitro и при экспериментальном инфекционном эндокардите. J Infect Dis. 2006; 194: 1267–75.

    Артикул CAS PubMed Google Scholar

  • 54.

    Berube BJ, Bubeck Wardenburg J. Staphylococcus aureus α-токсин: интриги почти столетие. Токсины. 2013; 5: 1140–66.

    PubMed Central Статья PubMed Google Scholar

  • 55.

    Нильссон И.М., Хартфорд О., Фостер Т., Тарковски А. Альфа-токсин и гамма-токсин совместно способствуют вирулентности Staphylococcus aureus при септическом артрите мышей. Infect Immun. 1999; 67: 1045–9.

    PubMed Central CAS PubMed Google Scholar

  • 56.

    Muñoz-Planillo R, Franchi L, Miller LS, Núñez G. Критическая роль гемолизинов и бактериальных липопротеинов в индуцированной Staphylococcus aureus активации воспаления Nlrp3. Дж. Иммунол Балтим М. Д. 1950. 2009; 183: 3942–8.

    Google Scholar

  • 57.

    Спаан А.Н., Рейес-Роблес Т., Бадью С., Коше С., Богуславски К.М., Юн П. и др. Staphylococcus aureus нацелен на рецептор антигена Даффи для хемокинов (DARC), чтобы лизировать эритроциты.Клеточный микроб-хозяин. 2015; 18: 363.

    Артикул CAS PubMed Google Scholar

  • 58.

    Bergdoll MS. Важность стафилококков, производящих энтеротоксин в нанограммах. Zentralblatt Für Bakteriol Int J Med Microbiol. 1995; 282: 1–6.

    Артикул CAS Google Scholar

  • 59.

    Salgado-Pabón W., Breshears L, Spaulding AR, Merriman JA, Stach CS, Horswill AR, et al.Суперантигены имеют решающее значение для Staphylococcus aureus Инфекционный эндокардит, сепсис и острое повреждение почек. mBio 2013, 4. doi: 10.1128 / mBio.00494-13

  • DM Lab 13

    DM Lab 13

    I. ВВЕДЕНИЕ

    Нормальная флора слизистых оболочек человека насчитывает среди своих членов а разновидность грамположительных кокков. Два важных рода, стафилококки и Стрептококки представлены в сегодняшнем лабораторном упражнении.

    A. Стафилококк

    Род Staphylococcus по большей части состоит из двух заслуживающих внимания видов: Staphylococcus aureus и Staphylococcus epidermidis . S. aureus главный возбудителя и могут вызвать нагноение, образование абсцесса, различные гнойные инфекции и даже смертельный сепсис. S. epidermidis является обычно непатогенным но при определенных условиях может вызвать заболевание.Стафилококки производят фермент , каталаза , что отличает их от стрептококков, которых нет. По определению, штаммы стафилококков, которые продуцируют фермент коагулазу , представляют собой S. aureus , что отличает их от всех других стафилококков, которые этого не делают. Большинство штаммы S. aureus продуцируют недифференцируемый золотисто-желтый пигмент и зону чистый бета-гемолиз на агаре, содержащем кровь.Непатогенные штаммы стафилококков обычно образуют белые или сероватые колонии и не содержат коагулазы. Они могут быть гемолитический, но обычно нет.

    B. STREPTOCOCCUS

    Род Streptococcus содержит множество видов, которые считаются патогенами. Стрептококки, вероятно, вызывают большее разнообразие типов клинических заболеваний, чем любые другой род. Наиболее часто выделяемые и / или наиболее вирулентные штаммы стрептококков:

    • Стрептококк группы А ( Streptococcus pyogenes ).Эти бета-гемолитический, чувствительны к бацитрацину; вызывают сепсис, импетиго, фарингит, острый гломерулонефрит (АГН), ревматическая лихорадка, раневые инфекции и т. д.
    • Streptococcus группы B ( Streptococcus agalactiae ). Это бета-гемолитические, резистентность к бацитрацину, положительный результат теста CAMP, и они являются основной причиной послеродовой сепсис и неонатальный менингит. Этот организм обычно изолированы от женских половых путей.
    • Стрептококк группы C . Это бета-гемолитики, устойчивые к бацитрацину, CAMP тест отрицательный и часто является осложняющим фактором при раневых инфекциях.
    • Стрептококк группы D . Обычно это альфа или гамма, и обычно они находятся в кишечного тракта. Есть две подгруппы, разделенные на основе сопротивления. до высоких концентраций соли.
      • Энтерококк группы D : может расти высоко (6.5%) концентрации соли.
      • Группа D Не энтерококк : не может расти в 6,5% соли
    • Streptococcus pneumoniae — овальный диплококк, который является оптохином. чувствительный, а- гемолитическим и вызывает пневмонию, раневые инфекции, менингит, сепсис и отит у детей.

    Способность гемолизовать эритроциты варьируется у разных видов животных. Streptococcus , и это первая особенность, наблюдаемая при классификации видов.В Гемолитические реакции стрептококков на агаре с овечьей кровью (БАП):

    • АЛЬФА-ГЕМОЛИЗ — зеленоватое изменение цвета кровяного агара в зона вокруг колоний или под ними. Слово «вириданс» означает зеленый, и эти альфа-гемолитические стрептококки часто называют «виридансами». стрептококки.
    • БЕТА-ГЕМОЛИЗ — полный лизис эритроцитов в зоне вокруг отдельные колонии.В этой зоне среда становится почти прозрачный.
    • ГАММА-ГЕМОЛИЗ — отсутствие реакции (видимых изменений вокруг отдельные колонии). Гемолиза не происходит.

    II. ЛАБОРАТОРНАЯ РАБОТА

    Поставляемые материалы: (индивидуально)
    • 1 пластина с кровяным агаром (BAP) с 1 неизвестным стафилококком
    • 1 БАТ с 1 неизвестным стрептококком
    • 1 пластина с агаром с желчью и эскулином ( розовая точка )
    • 1 6.5% раствор NaCl ( зеленая крышка )
    • 1 BAP (разделен на 2 части линией маркера)
    • 1 плазменная трубка кролика ( фиолетовый колпачок )
    • 1 чашка Петри с дисками дифференциации A (бацитрацин) и P (оптохин)
    • 1 тюбик Staphylococcus aureus (в бульоне для теста CAMP) ( желтая крышка )
    • 1 бутылка 3% перекиси водорода (h3O2)
    Процедура:
    1. У каждого студента свои:
      • Стафилококк неизвестен с кодовым номером,
      • Streptococcus неизвестен с кодовым номером.
    2. Каждый студент:
      • должен подготовить окраску по Граму его / ее Staphylococcus и Streptococcus неизвестных.
      • должен провести тест на каталазу на своем Staphylococcus и Streptococcus неизвестных. Это определит, что есть что.
      • должен провести тест на коагулазу на его / ее Staphylococcus unknown.
      • должен привить его / ее Streptococcus неизвестно о подходящем пластины, как описано ниже.
      • должен определить гемолиз его / ее Streptococcus unknown и при необходимости настройте тест на чувствительность к бацитрацину или оптохину. (Если этот тест проводится на неизвестном стафилококке, баллы будут вычтено.)

    КАТАЛАЗНЫЙ ТЕСТ:
    Тест каталазы различает группы микроорганизмов на основе производство каталазы.Этот тест неизменно положительный на стафилококки и отрицательный. на стрептококки. Каталаза — это фермент, расщепляющий перекись водорода на воду и кислород. Выделяемый кислород выглядит как крошечные пузырьки.
    1. Возьмите 1 или 2 изолированные колонии стерильной петлей и распределите по слайд. Не добавляйте физиологический раствор. Не включайте агар; клетки крови имеют каталаза в них.
    2. Добавьте в мазок 1 каплю 3% перекиси водорода и найдите энергичное выделение пузырьков.Пузырьки указывают на положительную реакцию на каталазу.
      РОД КАТАЛАЗНАЯ РЕАКЦИЯ
      Streptococcus Без пузырьков (без каталазы)
      Стафилококк Пузырьки (присутствует каталаза)

    ТЕСТ КОАГУЛАЗЫ:
    Коагулазный тест — самый надежный индикатор патогенных, токсин-продуцирующих штаммы стафилококков, i.э., на золотистый стафилококк. Наиболее патогенные штаммы Стафилококки продуцируют простафилкоагулазу, которая вступает в реакцию с активатором, аналогичным протромбин с образованием активного свертывающего агента, коагулазы. Коагулаза, в свою очередь, реагирует с фибриногеном, образующим фибрин для свертывания плазмы.
    1. Используйте стерильную петлю для посева, чтобы удалить тяжелый посевной материал с вашего предполагаемый стафилококк неизвестен (определяется окраской по Граму и Каталазный тест).
    2. Эмульгируйте этот рост в 1 пробирку с кроличьей плазмой, наклейте свое имя, и поместите в инкубатор 37C до следующего лабораторного периода.
    3. После инкубации обратите внимание на свертывание плазмы, наклонив пробирку для плазмы. и наблюдайте, затвердела жидкость или нет ( не проливать ).
    ОРГАНИЗМ ПРОИЗВОДСТВО КОАГУЛАЗЫ
    Staphylococcus aureus Сгусток (продуцируемый коагулазой)
    Staphylococcus epidermidis Нет сгустка (без коагулазы)

    ИДЕНТИФИКАЦИЯ ГРУППЫ СТРЕПТОККУСА:
    Чтобы определить ваш стрептококк как неизвестный, сначала необходимо его классифицировать. на основе его способности лизировать эритроциты барана (гемолиз).
    1. Тщательно исследуйте неизвестный БАТ (смотрите только на изолированные колонии на наличие это определение) и принять решение на основании следующих описаний, и демонстрационные тарелки за передним столом, какие из 3-х видов гемолиза ваши неизвестные экспонаты.
    АЛЬФА-ГЕМОЛИЗ:
    Неполный лизис эритроцитов с образованием зеленого цвета, окружающего колонию.
    БЕТА-ГЕМОЛИЗ:
    Полное разрушение эритроцитов с высвобождением гемоглобина.Полянка вокруг колонии.
    ГАММА-ГЕМОЛИЗ:
    В среде нет никаких изменений.
    1. Если ваша неизвестная стрептококковая инфекция обнаруживает a-гемолиз , то она может принадлежать к Группе D или быть Streptococcus pneumoniae или Viridans streptococcus. Полосите свой неизвестно одной половине БАТ и поместите один диск Optochin в область плотнейшая прививка. Затем используйте стерильную петлю для инокуляции желчи-эскулина. Чашка с агаром и 6.5% -ный бульон NaCl с неизвестным стрептококком. (Сделай это только в том случае, если ваше неизвестное обнаруживает a-гемолиз.)
    2. Если ваша неизвестная стрептококковая инфекция обнаруживает b-гемолиз , то нанесите полосу неизвестного на одну половину БАТ и поместите один диск с бацитрацином в область наиболее плотного прививка. Используйте другую половину BAP для теста CAMP (см. диаграмму). Разбейте свою неизвестную стрептококковую инфекцию. по прямой через изогнутую сторона тарелки. Стерилизуйте иглу и нанесите штриховку Staphylococcus aureus (Бульон , а не тарелка ) перпендикулярно вашей неизвестной полосе, оставляя 1 см пространство между ними .
    3. Если у вашей неизвестной стрептококковой инфекции нет гемолиза (g) , проигнорируйте шаги b и c. Вместо этого используйте стерильную петлю для инокуляции чашки с желчно-эскулиновым агаром и Бульон с 6,5% NaCl с неизвестным стрептококком.
    4. Инкубируйте чашки BAP в сосуде для свечей при 37 ° C до следующего лабораторного периода. Поместите бульон желчи-эскулина и 6,5% NaCl в инкубатор 37 ° C. Будь уверен напишите свое имя на всех своих материалах.
    5. Обратите внимание, что если культура стрептококка чувствительна к бацитрацину или оптичину, вы увидит область без роста вокруг диска.
    6. Выбросьте неизвестные пластины BAP. Материалы хранятся более 24 часов. довольно часто давать неубедительные или ошибочные результаты.
    ПРОЦЕДУРА ИСПЫТАНИЙ В ЛАГЕРЬЕ:

    CAMP-тест, проведенный на полноразмерной пластине с кровяным агаром. Обратите внимание усиленный гемолиз в форме стрелки.

    СЛЕДУЮЩИЙ ПЕРИОД ЛАБОРАТОРИИ

    1. Прочтите и запишите результаты неизвестных вам и вашему партнеру на Лист отчета, используя приведенную ниже таблицу:
      ИДЕНТИФИКАЦИЯ СТРЕПТОККУСА
      Группа Гемолиз Бацитрацин
      Чувствительность
      CAMP
      Тест
      Желчь-
      Эскулин
      Агар
      6.5%
      NaCl
      Бульон
      Оптохин
      Чувствительность
      A Бета +


      B Бета +


      C Бета


      D
      Enterococcus
      Alpha или
      Gamma


      + +
      D
      Не энтерококк
      Альфа или
      Гамма


      +
      Viridans Alpha

      +
      Streptococcus
      pneumoniae
      Alpha

      + +

    2. В конце этого лабораторного периода сдайте свой отчетный лист, помеченный вашим имя и неизвестные #.



    Несмотря на то, что мы делаем все возможное, чтобы эта информация была актуальной и точной, заявления найденные на этой странице предназначены только для информационных целей.
    Политика публикации WWW LSUMC, 23.09.96

    Ингибирование взаимодействия между α-гемолизином Staphylococcus aureus и мембраной эритроцитов с помощью гидролизуемых танинов: исследование структурно-зависимой активности

  • 1.

    Даглия М. Полифенолы как противомикробные агенты. Curr. Opin. Biotechnol. 23 , 174–181 (2012).

    CAS PubMed Google Scholar

  • 2.

    Винк М., Ашур М. Л. и Эль-Риди М. З. Вторичные метаболиты растений, ингибирующие переносчики ABC и обращающие устойчивость раковых клеток и микробов к цитотоксическим и антимикробным агентам. Перед. Microbiol. https://doi.org/10.3389/fmicb.2012.00130 (2012).

    Артикул PubMed PubMed Central Google Scholar

  • 3.

    Редондо, Л. М., Чакана, П. А., Домингес, Дж. Э. и Миякава, М. Е. Ф. Перспективы использования танинов в качестве альтернативы антимикробным факторам стимуляции роста у домашней птицы. Перед. Microbiol. https://doi.org/10.3389/fmicb.2014.00118 (2014).

    Артикул PubMed PubMed Central Google Scholar

  • 4.

    Крюгер, Э. и Браун, А.С. Ингибирование распознавания бактериальным токсином компонентов мембраны как антивирулентная стратегия. J Biol Eng. https://doi.org/10.1186/s13036-018-0138-z (2019).

    Артикул PubMed PubMed Central Google Scholar

  • 5.

    Funatogawa, K. et al. Антибактериальная активность гидролизуемых дубильных веществ, полученных из лекарственных растений, против Helicobacter pylori . Microbiol. Иммунол. 48 , 251–261 (2004).

    CAS PubMed Google Scholar

  • 6.

    Йи, С. М., Чжу, Л. Дж., Фу, Л. Л. и Ли, Дж. Р. Полифенолы чая ингибируют Pseudomonas aeruginosa через повреждение клеточной мембраны. Внутр. J. Food Microbiol. 144 , 111–117 (2010).

    CAS PubMed Google Scholar

  • 7.

    Аднан С. Н., Ибрагим Н. и Яакоб В. А. Нарушение синтеза метициллин-устойчивого белка Staphylococcus aureus танинами. Микробы 7 , 186–192 (2017).

    CAS PubMed PubMed Central Google Scholar

  • 8.

    Li, X. et al. Противомикробная активность и механизм процианидинов коры лиственницы против Staphylococcus aureus . Acta Biochim. Биофиз. Грех. (Шанхай) 49 , 1058–1066 (2017).

    CAS Google Scholar

  • 9.

    Шах, С., Стэплтон, П. Д. и Тейлор, П.W. Полифенол (-) — эпикатехин галлат нарушает секрецию белков вирулентности Staphylococcus aureus . Lett. Прил. Microbiol. 46 , 181–185 (2008).

    CAS PubMed Google Scholar

  • 10.

    Ли, Дж. Х., Парк, Дж. Х. и Ли, Дж. Флавон снижает выработку факторов вирулентности, стафилоксантина и α-гемолизина Staphylococcus aureus . Curr. Microbiol. 65 , 726–732 (2012).

    CAS PubMed Google Scholar

  • 11.

    Dong, J. et al. Апигенин облегчает симптомы пневмонии Staphylococcus aureus , подавляя выработку альфа-гемолизина. FEMS Microbiol. Lett. 338 , 124–131 (2013).

    CAS PubMed Google Scholar

  • 12.

    Tang, F. et al. Ингибирование экспрессии альфа-гемолизина ресвератролом ослабляет вирулентность Staphylococcus aureus . Microb. Патог. 127 , 85–90 (2019).

    CAS PubMed Google Scholar

  • 13.

    Lin, MH, Chang, FR, Hua, MY, Wu, YC & Liu, ST Ингибирующие эффекты 1,2,3,4,6-пента- O -галлиол-бета-d- глюкопираноза на образование биопленок Staphylococcus aureus . Антимикробный. Агенты Chemother. 55 , 1021–1027 (2011).

    CAS PubMed Google Scholar

  • 14.

    Trentin, D. S. et al. Танины, обладающие бактериостатическим действием, ослабляют Pseudomonas aeruginosa адгезию и образование биопленок. PLoS ONE 8 , e66257. https://doi.org/10.1371/journal.pone.0066257 (2013).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 15.

    Hisano, M. et al. Ингибирующее действие катехина против суперантигена стафилококкового энтеротоксина B (SEB). Arch. Дерматол. Res. 295 , 183–189 (2003).

    CAS PubMed Google Scholar

  • 16.

    Verhelst, R., Schroyen, M., Buys, N. & Niewold, T. A. E. coli , инактивация термолабильного токсина (LT) специфическими полифенолами зависит от агрегации. Вет. Microbiol. 163 , 319–324 (2013).

    CAS PubMed Google Scholar

  • 17.

    Wang, J. et al. Гидрат морина ослабляет вирулентность Staphylococcus aureus , подавляя самосборку α-гемолизина. J. Appl. Microbiol. 118 , 753–763 (2015).

    CAS PubMed Google Scholar

  • 18.

    Сонг, М. et al. Апигенин защищает мышей от пневмококковой пневмонии, подавляя цитолитическую активность пневмолизина. Фитотерапия 115 , 31–36 (2016).

    CAS PubMed Google Scholar

  • 19.

    Shimamura, Y. et al. Связывание катехинов со стафилококковым энтеротоксином A. Molecules https://doi.org/10.3390/molecules23051125 (2018).

    Артикул PubMed PubMed Central Google Scholar

  • 20.

    Чанг, Э. Х., Хуанг, Дж., Лин, З. и Браун, А. С. Катехин-опосредованная реструктуризация бактериального токсина подавляет активность. Biochim. Биофиз. Acta Gen. Subj. 1863 , 191–198 (2019).

    CAS PubMed Google Scholar

  • 21.

    Wang, J. et al. Куркумин защищает мышей от пневмонии Staphylococcus aureus , препятствуя процессу самосборки α-гемолизина. Sci Rep. https://doi.org/10.1038/srep28254 (2016).

    Артикул PubMed PubMed Central Google Scholar

  • 22.

    Olchowik-Grabarek, E. et al. Роль структурных изменений биологических мембран под действием гидролизуемых танинов из листьев сумаха ( Rhus typhina L.) в их антигемолитическом и антибактериальном действии. J. Membr. Биол. 247 , 533–540 (2014).

    CAS PubMed Google Scholar

  • 23.

    Моригана, Н., Яхиро, К. и Нода, М. Ресвератрол, природное полифенольное соединение, ингибирует индуцированное холерным токсином накопление циклического АМФ в клетках Vero. Toxicon 56 , 29–35 (2010).

    Google Scholar

  • 24.

    Thakur, P. et al. Антигемолитические свойства, ингибирование гемагглютинации и разрушающие бактериальные мембраны свойства выбранных травяных экстрактов снижают вирулентность карбапенема Escherichia coli . Microb. Патог. 95 , 133–141 (2016).

    PubMed Google Scholar

  • 25.

    Kohda, C., Yanagawa, Y. & Shimamura, T. Галлат эпигаллокатехина подавляет внутриклеточное выживание Listeria monocytogenes в макрофагах. Biochem. Биофиз. Res. Commun. 365 , 310–315 (2008).

    CAS PubMed Google Scholar

  • 26.

    Tombola, F. et al. Полифенолы растений ингибируют VacA, токсин, секретируемый возбудителем желудочного заболевания. Helicobacter pylori . FEBS Lett. 543 , 184–189 (2003).

    CAS PubMed Google Scholar

  • 27.

    Остроумова, О.С., Ефимова, С.С., Щагина, Л.В. 5- и 4′-гидроксилированные флавоноиды влияют на стробирование напряжения одиночной поры альфа-гемолизина. Biochim. Биофиз. Acta. 1808 , 2051–2058 (2011).

    CAS PubMed Google Scholar

  • 28.

    Nnadozie, C. F. & Odume, O. N. Пресноводная среда как резервуар устойчивых к антибиотикам бактерий и их роль в распространении генов устойчивости к антибиотикам. Environ. Загрязнение. 254 , 113067 (2019).

    CAS PubMed Google Scholar

  • 29.

    Huijbers, P. M. et al. Роль окружающей среды в передаче устойчивости к противомикробным препаратам человеку: обзор. Environ. Sci. Technol. 49 , 11993–12004 (2015).

    ADS CAS PubMed Google Scholar

  • 30.

    Oliveira, D., Borges, A. & Simoes, M. Staphylococcus aureus токсинов и их молекулярная активность при инфекционных заболеваниях. Токсины https://doi.org/10.3390/toxins10060252 (2018).

    Артикул PubMed PubMed Central Google Scholar

  • 31.

    Coker, M. S. et al. Взаимодействие стафилоксантина и энтеробактина с миелопероксидазой и химически активными формами хлора. Arch. Biochem. Биофиз. 646 , 80–89 (2018).

    CAS PubMed Google Scholar

  • 32.

    Yamashita, K. et al. Кристаллическая структура октмерной поры стафилококкового γ-гемолизина раскрывает двухкомпонентный механизм образования поры β-бочонка. Proc. Natl. Акад. Sci. США 108 , 17314–17319 (2011).

    ADS CAS PubMed Google Scholar

  • 33.

    Towle, K. M. et al. Структура раствора фенолрастворимых модулялинов α1, α3 и β2, факторы вирулентности из Staphylococcus aureus . Биохимия 55 , 4798–4806 (2016).

    CAS PubMed Google Scholar

  • 34.

    Фраунхольц, М. и Синха, Б. Внутриклеточное Золотистый стафилококк : живите и дайте умереть. Перед. Cell Infect. Microbiol. https://doi.org/10.3389/fcimb.2012.00043 (2012).

    Артикул PubMed PubMed Central Google Scholar

  • 35.

    Скальберт А. Антимикробные свойства дубильных веществ. Фитохимия 30 , 3875–3883 (1991).

    CAS Google Scholar

  • 36.

    Buzzini, P. et al. Антимикробная и противовирусная активность гидролизуемых дубильных веществ. Мин. Rev. Med. Chem. 8 , 1179–1187 (2008).

    CAS Google Scholar

  • 37.

    Мавлянов С.М., Исламбеков Ш., Исмаилов А.И., Далимов Д.Н., Абдулладжанова Н.Г. Растительные дубильные вещества. Chem. Nat. Compd. 37 , 1–24 (2001).

    CAS Google Scholar

  • 38.

    Серрано, Дж., Пуппонен-Пимиа, Р., Дауэр, А., Аура, А. М. и Саура-Каликсто, Ф. Танины: современные знания об источниках пищи, потреблении, биодоступности и биологических эффектах. Мол. Nutr. Food Res. 53 , 310–329 (2009).

    Google Scholar

  • 39.

    Йошида Т., Амакура Ю. и Йошимура М. Структурные особенности и биологические свойства эллагитаннинов некоторых семейств растений отряда Myrtales. Внутр.J. Mol. Sci. 11 , 79–106 (2010).

    CAS PubMed PubMed Central Google Scholar

  • 40.

    Lipińska, L., Klewicka, E. & Sójka, M. Структура, встречаемость и биологическая активность эллагитаннинов: общий обзор. Acta Sci. Pol. Technol. Алимент. 13 , 289–299 (2014).

    PubMed Google Scholar

  • 41.

    Акияма, Х., Fujii, K., Yamasaki, O., Oono, T. & Iwatsuki, K. Антибактериальное действие некоторых танинов против Staphylococcus aureus . J. Antimicrob. Chemother. 48 , 487–491 (2001).

    CAS PubMed Google Scholar

  • 42.

    Фрейзер, Р. А., Пападопулу, А. И., Мюллер-Харви, Д., Киссун, Д. и Грин, Р. Дж. Исследование взаимодействий белок-танин с помощью микрокалориметрии изотермического титрования. Дж.Agric. Food Chem. 51 , 5189–5195 (2003).

    CAS PubMed Google Scholar

  • 43.

    Hofmann, T. et al. Связывание с белками и вяжущий вкус полимерного процианидина, 1,2,3,4,6-пента- O -галлоил-β-d-глюкопиранозы, касталагина и грандинина. J. Agric. Food Chem. 54 , 9503–9509 (2006).

    CAS PubMed PubMed Central Google Scholar

  • 44.

    Девилль, Э. Р., Грин, Р. Дж., Мюллер-Харви, И., Уиллоуби, И. и Фрейзер, Р. А. Структуры гидролизуемых танинов влияют на относительную силу связывания глобулярных и случайных клубков с белками. J. Agric. Food Chem. 55 , 4554–4561 (2007).

    CAS PubMed Google Scholar

  • 45.

    Dobreva, M.A. et al. Размер и молекулярная гибкость влияют на связывание эллагитаннинов с бычьим сывороточным альбумином. J. Agric. Food Chem. 62 , 9186–9194 (2014).

    CAS PubMed Google Scholar

  • 46.

    Sekowski, S. et al. Влияние валонеоильных групп на взаимодействие между танинами Euphorbia и сывороточным альбумином человека. J. Lumin. 194 , 170–178 (2018).

    CAS Google Scholar

  • 47.

    Kashiwada, Y. et al. Танины как селективные ингибиторы протеинкиназы C. Bioorg. Med. Chem. Lett. 2 , 239–244 (1992).

    CAS Google Scholar

  • 48.

    Dobreva, M.A. et al. Связывание пентагаллоилглюкозы с двумя глобулярными белками происходит через несколько участков поверхности. Биомакромол 12 , 710–715 (2011).

    CAS Google Scholar

  • 49.

    Shimamura, Y. et al. Полифенолы растительного происхождения взаимодействуют со стафилококковым энтеротоксином А и подавляют активность токсина. PLoS ONE 11 , e0157082. https://doi.org/10.1371/journal.pone.0157082 (2016).

    CAS Статья PubMed PubMed Central Google Scholar

  • 50.

    O’Reilly, M., de Azavedo, JC, Kennedy, S. & Foster, T.J. Инактивация гена альфа-гемолизина Staphylococcus aureus 8325-4 посредством сайт-направленного мутагенеза и исследования экспрессии его гемолизинов. Microb. Патог. 1 , 125–138 (1986).

    PubMed Google Scholar

  • 51.

    Smith, M. L. & Prince, S. A. Производит альфа-токсины, а не бета- или гамма-токсины. J. Pathol. Бактериол. 47 , 379–393 (1938).

    CAS Google Scholar

  • 52.

    Бернхеймер А. В. и Шварц Л. Л. Выделение и состав стафилококкового альфа-токсина. J. Gen. Microbiol. 30 , 455–468 (1963).

    CAS PubMed Google Scholar

  • 53.

    Гурнев П.А., Несторович Е.М. Каналообразующие бактериальные токсины в биочувствительности и доставке макромолекул. Токсины (Базель) 6 , 2483–2540 (2014).

    CAS Google Scholar

  • 54.

    Берубе, Б. Дж. И Варденбург, Б.J. Staphylococcus aureus α-токсин: интриги почти столетие. Токсины (Базель) 5 , 1140–1166 (2013).

    Google Scholar

  • 55.

    Ульрих, Н. П., Маричич, М., Ота, М., Сентюрк, М. и Абрам, В. Взаимодействие кемпферола и кверцетина с модельными липидными мембранами. Food Res. Int. 71 , 146–154 (2015).

    Google Scholar

  • 56.

    Silva, D. C. N. et al. Оптический пинцет как новый биомедицинский инструмент для измерения дзета-потенциала накопленных эритроцитов. PLoS ONE 7 , e31778. https://doi.org/10.1371/journal.pone.0031778 (2012).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 57.

    Карас Д., Ульрихова Дж. И Валентова К. Галлоилирование полифенолов изменяет их биологическую активность. Food Chem. Toxicol. 105 , 223–240 (2017).

    CAS PubMed Google Scholar

  • 58.

    Shimamura, Y. et al. Взаимодействие различных процианидинов яблока и стафилококкового энтеротоксина А и их ингибирующие эффекты на активность токсина. Токсины (Базель) 9 , 243–257 (2017).

    Google Scholar

  • 59.

    Икигай, Х., Тода, М., Окубо, С., Хара, Ю. и Шимамура, Т. Взаимосвязь между антигемолизиновой активностью и структурой катехинов и теафлавинов. Нихон. Saikingaku Zasshi. 45 , 913–919 (1990).

    CAS PubMed Google Scholar

  • 60.

    Qiu, J. et al. Байкалин защищает мышей от пневмонии Staphylococcus aureus посредством ингибирования цитолитической активности α-гемолизина. J. Infect. Дис. 206 , 292–301 (2012).

    CAS PubMed Google Scholar

  • 61.

    Qiu, J. et al. Молекулярное моделирование раскрывает новый механизм ингибирования и способ связывания древесных природных соединений с α-гемолизином Staphylococcal . PLoS ONE 8 , e80197. https://doi.org/10.1371/journal.pone.0080197 (2013).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 62.

    Чой, О., Яхиро, К., Моринага, Н., Миядзаки, М. и Нода, М. Ингибирующие эффекты различных полифенолов растений на токсичность стафилококкового альфа-токсина. Microb. Патог. 42 , 215–224 (2007).

    CAS PubMed Google Scholar

  • 63.

    Ле Бурвеллек, К. и Ренар, К. М. Взаимодействия между полифенолами и макромолекулами: методы и механизмы количественной оценки. Crit. Rev. Food Sci.Nutr. 52 , 213–248 (2012).

    PubMed Google Scholar

  • 64.

    Furlan, A. L., Saad, A., Dufourc, E. J. & Gean, J. Катехин танина винограда и этанол разжижают имитаторы мембран полости рта, содержащие умеренное количество холестерина: влияние на дегустацию вин ?. Biochimie 130 , 41–48 (2016).

    CAS PubMed Google Scholar

  • 65.

    Тараховский Ю.С. Растительные полифенолы в межклеточном взаимодействии и коммуникации. Сигнальное поведение растений. 3 , 609–611 (2008).

    PubMed PubMed Central Google Scholar

  • 66.

    Verstraeten, S. V., Jaggers, G. K., Fraga, C. G. & Oteiza, P. I. Процианидины могут взаимодействовать с липидными рафтами мембран клеток Caco-2: участие холестерина. Biochim. Биофиз. Acta. 1828 , 2646–2653 (2013).

    CAS PubMed Google Scholar

  • 67.

    Sekowski, S. et al. Биомолекулярные взаимодействия танина, выделенного из Oenothera gigas , с липосомами. J. Membr. Биол. 249 , 171–179 (2016).

    CAS PubMed Google Scholar

  • 68.

    Włoch, A. et al. Физические эффекты экстракта гречихи на биологическую мембрану in vitro и его защитные свойства. J. Membr. Биол. 249 , 155–170 (2016).

    PubMed Google Scholar

  • 69.

    DuMont, A. L. & Torres, V. J. Нацеливание на клетки Staphylococcus aureus порообразующих токсинов: речь идет не только о липидах. Trends Microbiol. 22 , 21–27 (2014).

    CAS PubMed Google Scholar

  • 70.

    Thurnheer, S., Abrami, L., Bischofberger, M. & van der Goot, F. G. Staphylococcus aureus альфа-токсин может связываться с холестерин-чувствительными головными группами фосфатидилхолина. Вопросы https://doi.org/10.19185/matters.201602000024 (2016).

    Артикул Google Scholar

  • 71.

    Sekowski, S. et al. Биофизические исследования взаимодействия гидролизуемых танинов, выделенных из Oenothera gigas и Geranium sanguineum , с сывороточным альбумином человека. Colloids Surf. B Биоинтерфейсы. 123 , 623–628 (2014).

    CAS PubMed Google Scholar

  • 72.

    Beretta, G., Artali, R., Caneva, E. & Facino, RM Конформация трехмерной структуры 1,2,3,4,6-пентагаллоил-β-d-глюкопиранозы (PGG) by 1 H ЯМР, NOESY и теоретические исследования и мембранное взаимодействие в смоделированном фосфолипидном бислое: первое понимание. Magn. Резон.Chem. 49 , 132–136 (2011).

    CAS PubMed Google Scholar

  • 73.

    Каргинов В.А. и др. Ингибирование α-гемолизина S. aureus и летального токсина B. anthracis производными β-циклодекстрина. Bioorg. Med. Chem. 15 , 5424–5431 (2007).

    CAS PubMed PubMed Central Google Scholar

  • 74.

    Мело, М. С. А., Тейшейра, Л. Р., Пол-Фачин, Л. и Родригес, С. Р. Ингибирование гемолитической активности, вызванной Staphylococcus aureus альфа-гемолизином посредством комплексов изатин-медь Шиффа (II). FEMS Microbiol. Lett. https://doi.org/10.1093/femsle/fnv207 (2016).

    Артикул PubMed Google Scholar

  • 75.

    Абдулладжанова Н.Г., Мавлянов С.М., Далимов Д.Н. Полифенолы некоторых растений семейства Euphorbiaceae. Chem. Nat. Compd. 39 , 399–400 (2003).

    CAS Google Scholar

  • 76.

    Olchowik-Grabarek, E., Mavlyanov, S., Abdullajanova, N., Gieniusz, R. & Zamaraeva, M. Специфичность гидролизуемых танинов из Rhus typhina L. к окислителям в клетках и клетках. бесплатные модели. Заявл. Biochem. Biotechnol. 181 , 495–510 (2017).

    CAS PubMed Google Scholar

  • 77.

    Klancnik, A., Pirskernik, S., Jarsek, B. & Mozina, S. S. Оценка методов диффузии и разбавления для определения антибактериальной активности растительных экстрактов. J. Microbiol. Методы 81 , 121–126 (2010).

    CAS PubMed Google Scholar

  • 78.

    Olchowik, E. et al. Стабилизация эритроцитов против окислительного и гипотонического стресса дубильными веществами, выделенными из листьев сумаха ( Rhus typhina L.) и косточек винограда ( Vitis vinifera L.). Cell Mol. Биол. Lett. 17 , 333–348 (2012).

    CAS PubMed PubMed Central Google Scholar

  • 79.

    Dobrzyńska, I., Gęgotek, A., Gajko, E., Skrzydlewska, E. & Figaszewski, Z. A. Влияние рутина на физико-химические свойства разрушения мембраны фибробластов кожи под действием УФ-излучения. Chem. Биол. Взаимодействовать. 282 , 29–35 (2018).

    PubMed Google Scholar

  • Staphylococcus aureus усиливает гемолитическую активность бактерий комплекса Burkholderia cepacia (Bcc)

  • 1.

    Surette MG (2014) Микробиом легких с кистозным фиброзом. Ann Am Thorac Soc 11 (Дополнение 1): S61-65. https://doi.org/10.1513/AnnalsATS.201306-159MG

    Статья PubMed Google Scholar

  • 2.

    Granchelli AM, Adler FR, Keogh RH, Kartsonaki C, Cox DR, Liou TG (2018) Микробные взаимодействия в дыхательных путях при муковисцидозе.J Clin Microbiol. https://doi.org/10.1128/JCM.00354-18

    Статья PubMed PubMed Central Google Scholar

  • 3.

    Lyczak JB, Cannon CL, Pier GB (2002) Инфекции легких, связанные с муковисцидозом. Clin Microbiol Rev 15 (2): 194–222

    CAS Статья Google Scholar

  • 4.

    Chmiel JF, Aksamit TR, Chotirmall SH, Dasenbrook EC, Elborn JS, LiPuma JJ, Ranganathan SC, Waters VJ, Ratjen FA (2014) Лечение антибиотиками легочных инфекций при муковисцидозе.I. Микробиом, устойчивый к метициллину Staphylococcus aureus , грамотрицательные бактерии и множественные инфекции. Ann Am Thorac Soc 11 (7): 1120–1129. https://doi.org/10.1513/AnnalsATS.201402-050AS

    Статья PubMed PubMed Central Google Scholar

  • 5.

    Vanderhelst E, De Meirleir L, Verbanck S, Pierard D, Vincken W, Malfroot A (2012) Распространенность и влияние на FEV (1) снижение хронической метициллин-резистентной колонизации Staphylococcus aureus (MRSA) в пациенты с муковисцидозом.Одноцентровое исследование методом случай-контроль с участием 165 пациентов. J Cyst Fibros 11 (1): 2–7. https://doi.org/10.1016/j.jcf.2011.08.006

    CAS Статья PubMed Google Scholar

  • 6.

    Dasenbrook EC, Checkley W, Merlo CA, Konstan MW, Lechtzin N, Boyle MP (2010) Связь между метициллинорезистентностью дыхательных путей Staphylococcus aureus и выживаемостью при муковисцидозе. JAMA 303 (23): 2386–2392. https://doi.org/10.1001/jama.2010.791

    CAS Статья PubMed Google Scholar

  • 7.

    Govan JR, Brown AR, Jones AM (2007) Развитие эпидемиологии Pseudomonas aeruginosa и комплекса Burkholderia cepacia при муковисцидозе легких. Future Microbiol 2 (2): 153–164. https://doi.org/10.2217/17460913.2.2.153

    Статья PubMed Google Scholar

  • 8.

    Zemanick ET, Hoffman LR (2016) Муковисцидоз: микробиология и реакция хозяина.Педиатр Clin N Am 63 (4): 617–636. https://doi.org/10.1016/j.pcl.2016.04.003

    Статья Google Scholar

  • 9.

    Hotterbeekx A, Kumar-Singh S, Goossens H, Malhotra-Kumar S (2017) Взаимодействие in vivo и in vitro между Pseudomonas aeruginosa и Staphylococcus spp. Front Cell Infect Microbiol 7: 106. https://doi.org/10.3389/fcimb.2017.00106

    CAS Статья PubMed PubMed Central Google Scholar

  • 10.

    Коэн Т.С., Хиллиард Дж. Дж., Джонс-Нельсон О., Келлер А. Е., О’Дей Т., Ткачик С., ДиДжиандоменико А., Гамильтон М., Пеллетье М., Ван К., Дип Б. А., Ле В. Т., Ченг Л., Сузич Дж., Стовер К. К., Sellman BR (2016) Staphylococcus aureus альфа-токсин потенцирует оппортунистические бактериальные инфекции легких. Sci Transl Med. https://doi.org/10.1126/scitranslmed.aad9922

    Статья PubMed PubMed Central Google Scholar

  • 11.

    Ji Y, Bolhuis A, Watson ML (2019) Staphylococcus aureus продукты подрывают вызванный Burkholderia cenocepacia воспалительный ответ в эпителиальных клетках дыхательных путей.J Med Microbiol 68 (12): 1813–1822. https://doi.org/10.1099/jmm.0.001100

    CAS Статья PubMed Google Scholar

  • 12.

    Hutchison ML, Poxton IR, Govan JR (1998) Burkholderia cepacia продуцирует гемолизин, который способен индуцировать апоптоз и дегрануляцию фагоцитов млекопитающих. Infect Immun 66 (5): 2033–2039

    CAS Статья Google Scholar

  • 13.

    Thomson EL, Dennis JJ (2012) A Burkholderia cepacia Токсин, синтезируемый не рибосомным пептидом, является гемолитическим и необходим для полной вирулентности. Вирулентность 3 (3): 286–298. https://doi.org/10.4161/viru.19355

    Статья PubMed PubMed Central Google Scholar

  • 14.

    Limoli DH, Whitfield GB, Kitao T, Ivey ML, Davis MR Jr, Grahl N, Hogan DA, Rahme LG, Howell PL, O’Toole GA, Goldberg JB (2017) Pseudomonas aeruginosa перепроизводство альгината способствует сосуществованию с Staphylococcus aureus в модели респираторной инфекции кистозного фиброза.MBio. https://doi.org/10.1128/mBio.00186-17

    Статья PubMed PubMed Central Google Scholar

  • 15.

    Ву Б., Чен М., Кроуфорд Р.Дж., Иванова Е.П. (2009) Бактериальные внеклеточные полисахариды, участвующие в образовании биопленок. Молекулы 14 (7): 2535–2554. https://doi.org/10.3390/molecules14072535

    CAS Статья PubMed PubMed Central Google Scholar

  • 16.

    Bhakdi S, Tranum-Jensen J (1991) Альфа-токсин Staphylococcus aureus . Microbiol Rev 55 (4): 733–751

    CAS Статья Google Scholar

  • 17.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *